remB

remB
168

involved in the activation of biofilm matrix biosynthetic operons, acts in parallel to [protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR], [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB], and [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]

locus
BSU_00050
Molecular weight
5.80 kDa
pI
8.8
Protein length
Gene length
function
regulation of [wiki|biofilm formation]
product
regulator of the extracellular matrix
essential
no
synonyms
remB, yaaB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
4,567 → 4,812
Phenotypes of a mutant
smooth colonies on MsGG medium, no [wiki|biofilm formation] [Pubmed|22113911]
The protein
Structure
[AF|P37525]
Expression and Regulation
Operons
genes
[gene|FB1C21A94697E5B9D29C0F3B9C9F36E57BCBD237|yaaA]-[gene|EBE03AEC7EC594A3115A7A72194BDFF300AA0BFA|recF]-[gene|CBC76FB453569550F14FE5015C05D45985C04979|remB]-[gene|AA42910B71348EFEA4165CFFCEF1E497897B9DDC|gyrB]-[gene|B207C7328177924B16F1C606F667BEADF12CA069|gyrA]
description
[Pubmed|22383849]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|2987848], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|FB1C21A94697E5B9D29C0F3B9C9F36E57BCBD237|yaaA]→[gene|B207C7328177924B16F1C606F667BEADF12CA069|gyrA]

2022-09-13 21:19:35

Jstuelk

36

7cfa0ee36064fef3f7a603b125c665e7c80f35bd

A6120E836ADBF13F415EC7E80D314C2CE36E1D65

Biological materials
Mutant
MGNA-B880 (yaaB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1879 NBRP B. subtilis, Japan]
BKE00050 (Δ[gene|CBC76FB453569550F14FE5015C05D45985C04979|remB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE00050 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATACAATTGCTCACCTCATT,  downstream forward: _UP4_TAGAAATTTTTTATCACGAA
BKK00050 (Δ[gene|CBC76FB453569550F14FE5015C05D45985C04979|remB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK00050 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATACAATTGCTCACCTCATT,  downstream forward: _UP4_TAGAAATTTTTTATCACGAA
labs
[wiki|Daniel Kearns], Indiana University, Bloomington, USA, [http://www.bio.indiana.edu/facultyresearch/faculty/Kearns.html homepage]
References
2987848,19363116

CBC76FB453569550F14FE5015C05D45985C04979

Page visits: 2729

Time of last update: 2022-10-03 21:45:42

Author of last update: Jstuelk