SubtiWiki SubtiWiki
ydzE

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

ydzE
168

unknown

locus
BSU_05140
Molecular weight
8.40 kDa
pI
6.92
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
ydzE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0697

This gene is a member of the following regulons

Gene
Coordinates
561,180 → 561,416
The protein
Protein family
[wiki|EamA transporter family] (according to UniProt)
[wiki|Domains]
[wiki|EamA domain] (aa 2-70) (according to UniProt)
Expression and Regulation
Operons
genes
[gene|24A86A4846187E6026A2B7645DC4B7C70908942E|ydeC]-[gene|CBEB1C62D727CF320E82C3ED636894B50F11E0AE|ydzE]
description
[pubmed|22383849]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|11532142], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|24A86A4846187E6026A2B7645DC4B7C70908942E|ydeC]->[gene|CBEB1C62D727CF320E82C3ED636894B50F11E0AE|ydzE]

2021-12-17 17:00:26

Bzhu

6

59bc0174fd3aef20a892bb083ff6607114d252b5

61AFF2F491CBF04495E610BD7F03138B1FEF0965

Biological materials
Mutant
MGNA-C165 (ydzE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2163 NBRP B. subtilis, Japan]
BKE05140 (Δ[gene|CBEB1C62D727CF320E82C3ED636894B50F11E0AE|ydzE]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05140 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAAAGGCCACCTAGAATTT,  downstream forward: _UP4_TAACAAAAAAAAGCAAACTA
BKK05140 (Δ[gene|CBEB1C62D727CF320E82C3ED636894B50F11E0AE|ydzE]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05140 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAAAGGCCACCTAGAATTT,  downstream forward: _UP4_TAACAAAAAAAAGCAAACTA

CBEB1C62D727CF320E82C3ED636894B50F11E0AE

Page visits: 598

Time of last update: 2022-01-08 14:54:48

Author of last update: Melvin.boenninger