yjmD

yjmD
168

galactitol-1-phosphate dehydrogenase

locus
BSU_12330
Molecular weight
36.61 kDa
pI
6.11
Protein length
Gene length
function
utilization of dulcitol
product
galactitol-1-phosphate dehydrogenase
essential
no
synonyms
yjmD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1063

This gene is a member of the following regulons

Gene
Coordinates
1,304,442 → 1,305,461
The protein
Protein family
[wiki|zinc-containing alcohol dehydrogenase family] (according to UniProt)
Structure
[PDB|4ILK] (from E. coli, 40% identity)
[AF|O35045]
Expression and Regulation
Operons
genes
[gene|3AEA5D769B89E676C916FD8934D762B4C9A02AA2|yjmC]-[gene|CC55984E31C5698668CCCD4AC6E2210B2B41ACAB|yjmD]-[gene|A0A6D36BEC397345A1D17E6A7C34E1F612FD46C7|uxuA]-[gene|B886E504A767343042DE9BF4E23E6798D124A2CF|yjmF]-[gene|6D08E897DD697523FD0720704A25AD4472075B6C|exuT]-[gene|69B143987DCF73B5D080E3FD87A6CA2940E07DA8|exuR]-[gene|A1C64447E0074B06C9210CC51680273FAAE703FA|uxaB]-[gene|ED29D2DE48AADEA09C90F08B6021555C357946B4|uxaA]
description
[Pubmed|9882655]
regulation
induced by galacturonate ([protein|search|ExuR]) [Pubmed|9882655]
regulatory mechanism
[protein|69B143987DCF73B5D080E3FD87A6CA2940E07DA8|exuR]: repression, in the absence of inducer, in [regulon|protein:69B143987DCF73B5D080E3FD87A6CA2940E07DA8|exuR regulon]
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [pubmed|9882655] [pubmed|10666464], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|9882655], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]: sigma factor, [Pubmed|15699190,9882655], in [regulon|protein:3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE regulon]
Open in new tab

[gene|3AEA5D769B89E676C916FD8934D762B4C9A02AA2|yjmC]→[gene|ED29D2DE48AADEA09C90F08B6021555C357946B4|uxaA]

2022-11-16 14:50:47

ghost

23

e9b60dda83535baf9252c89c7130d2fdeb844e6f

417675688A3DB0A933113CA632D3321516D969A2

genes
[gene|5A0C29C7E218701727523885D01A48D02266B421|uxaC]-[gene|59CD3E4C24326542D9C85BB6FE64FBF49869EB55|yjmB]-[gene|3AEA5D769B89E676C916FD8934D762B4C9A02AA2|yjmC]-[gene|CC55984E31C5698668CCCD4AC6E2210B2B41ACAB|yjmD]-[gene|A0A6D36BEC397345A1D17E6A7C34E1F612FD46C7|uxuA]-[gene|B886E504A767343042DE9BF4E23E6798D124A2CF|yjmF]-[gene|6D08E897DD697523FD0720704A25AD4472075B6C|exuT]-[gene|69B143987DCF73B5D080E3FD87A6CA2940E07DA8|exuR]-[gene|A1C64447E0074B06C9210CC51680273FAAE703FA|uxaB]-[gene|ED29D2DE48AADEA09C90F08B6021555C357946B4|uxaA]
description
[Pubmed|9882655]
regulation
induced by galacturonate ([protein|search|ExuR]) [Pubmed|9882655]
regulatory mechanism
[protein|69B143987DCF73B5D080E3FD87A6CA2940E07DA8|exuR]: repression, in the absence of inducer, in [regulon|protein:69B143987DCF73B5D080E3FD87A6CA2940E07DA8|exuR regulon]
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [pubmed|9882655] [pubmed|10666464], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|9882655], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|5A0C29C7E218701727523885D01A48D02266B421|uxaC]→[gene|ED29D2DE48AADEA09C90F08B6021555C357946B4|uxaA]

2022-11-17 14:10:32

ghost

20

0325999ea185bfaaf2dea87e1701479c52256033

A15F6E93B04DC8C4B59B7976DAC34CE9AC0B8E51

Biological materials
Mutant
MGNA-A368 (yjmD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/368 NBRP B. subtilis, Japan]
BKE12330 (Δ[gene|CC55984E31C5698668CCCD4AC6E2210B2B41ACAB|yjmD]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE12330 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTTGAACCGCTTTCATTT,  downstream forward: _UP4_TAAATGACTGAATCCGGAGG
BKK12330 (Δ[gene|CC55984E31C5698668CCCD4AC6E2210B2B41ACAB|yjmD]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK12330 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTTGAACCGCTTTCATTT,  downstream forward: _UP4_TAAATGACTGAATCCGGAGG
References
9579062,9882655,10666464,17573341,22900538

CC55984E31C5698668CCCD4AC6E2210B2B41ACAB

Page visits: 2047

Time of last update: 2022-11-27 10:37:55

Author of last update: Jstuelk