SubtiWiki SubtiWiki
yfiF

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yfiF
168

similar to transcription factor ([wiki|AraC family])

locus
BSU_08250
Molecular weight
36.04 kDa
pI
8.08
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yfiF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG4977

This gene is a member of the following regulons

Gene
Coordinates
898,961 → 899,905
The protein
Protein family
[wiki|AraC family]
[wiki|Domains]
[wiki|HTH araC/xylS-type domain] (aa 192-289) (according to UniProt)
Structure
[PDB|1BL0] (from E. coli, the [wiki|HTH araC/xylS-type domain], 35% identity) [pubmed|9724717]
Expression and Regulation
Operons
genes
[gene|CC5ED09FC661476160443898A083FF41A1F70DCE|yfiF]
description
(according to [http://dbtbs.hgc.jp/COG/prom/yfiF.html DBTBS]) null
Open in new tab

[gene|CC5ED09FC661476160443898A083FF41A1F70DCE|yfiF]

2021-10-15 21:19:04

ghost

1

c44225f1f7b6344ad2a6ae0676a1bcb7605c4ae0

A28078C628C6C40153E30510A78DBC4F1D7C1F6E

Biological materials
Mutant
MGNA-C296 (yfiF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2294 NBRP B. subtilis, Japan]
BKE08250 (Δ[gene|CC5ED09FC661476160443898A083FF41A1F70DCE|yfiF]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08250 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTAAACGCCTCCTAACA,  downstream forward: _UP4_TAAGATGTCCTGAAATGACA
BKK08250 (Δ[gene|CC5ED09FC661476160443898A083FF41A1F70DCE|yfiF]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08250 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTAAACGCCTCCTAACA,  downstream forward: _UP4_TAAGATGTCCTGAAATGACA
References
23504016,9724717

CC5ED09FC661476160443898A083FF41A1F70DCE

Page visits: 915

Time of last update: 2022-01-19 11:49:03

Author of last update: Jstuelk