ydzM

ydzM
168

unknown

locus
BSU_05099
Molecular weight
6.50 kDa
pI
9.101
Protein length
Gene length
function
unknown
product
unknown
essential
-
ec
null
synonyms
ydzM

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

The protein
Structure
[AF|Q9K3A9]
Paralogous protein(s)
[protein|FB3DA9FBDE088A95E76E0FB83B1B1E8B53EC2FC1|youB], (the sequences of the two proteins are identical)
Biological materials
Mutant
BP115 (ydzM::spc), available in [wiki|Fabian Commichau]'s lab
BKE05099 (Δ[gene|CC9FD5D0543E506758F11F9048F6A8ECD737D1A9|ydzM]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE05099 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATAAACTCCCCCGTTTA,  downstream forward: _UP4_TAAGGTGTAACACAAGGAGG
BKK05099 (Δ[gene|CC9FD5D0543E506758F11F9048F6A8ECD737D1A9|ydzM]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK05099 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATAAACTCCCCCGTTTA,  downstream forward: _UP4_TAAGGTGTAACACAAGGAGG

CC9FD5D0543E506758F11F9048F6A8ECD737D1A9

Page visits: 888

Time of last update: 2022-11-30 00:29:00

Author of last update: Bzhu