

phosphoribosylformylglycinamidine synthase

Molecular weight
9.62 kDa
Protein length
Gene length
purine biosynthesis
phosphoribosylformylglycinamidine synthase
purS, yexA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1828

This gene is a member of the following regulons

702,319 702,573
The protein
Catalyzed reaction/ biological activity
ATP + H2O + L-glutamine + N2-formyl-N1-(5-phospho-D-ribosyl)glycinamide --> 2-(formamido)-N1-(5-phospho-D-ribosyl)acetamidine + ADP + H+ + L-glutamate + phosphate (according to UniProt)
Protein family
UPF0062 family (single member, according to UniProt)
Additional information
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
expression activated by glucose (4.4 fold) [Pubmed|12850135]
regulatory mechanism
G-box: termination, ([wiki|riboswitch]) [pubmed|3036807,12787499], in [regulon|other_regulator:G-box|G-box]
[protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|purR]: repression, (molecular inducer: PRPP) [Pubmed|7638212,2536750], in [regulon|protein:A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|purR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|3036807], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab


2022-09-11 08:43:11





Biological materials
MGNA-A920 (yexA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/920 NBRP B. subtilis, Japan]
BKE06460 ([gene|CCD4DA969086181CFA33D6D241F2CAAE02E0C758|purS]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE06460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTTAAGCTGACATAAACTT, downstream forward: _UP4_GAGGTTGAGGAGGTAGTCGC
BKK06460 ([gene|CCD4DA969086181CFA33D6D241F2CAAE02E0C758|purS]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK06460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTTAAGCTGACATAAACTT, downstream forward: _UP4_GAGGTTGAGGAGGTAGTCGC


Page visits: 4492

Time of last update: 2022-10-07 00:26:27

Author of last update: Melvin.boenninger