ndhF

ndhF
168

subunit of a Na+:bicarbonate transporter [protein|CCDDC414E266D86B9027EA67EA565D87357023B3|MpsA]-[protein|E04C67FB0EA3FFEC8FB68440F4661505C3DFDA29|MpsB]

locus
BSU_01830
Molecular weight
55.30 kDa
pI
10.15
Protein length
Gene length
function
uptake of bicarbonate
product
subunit of a Na+:bicarbonate transporter
essential
no
synonyms
ndhF, ybxE, mpsA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1009

This gene is a member of the following regulons

Gene
Coordinates
205,409 → 206,926
Phenotypes of a mutant
severe growth defect [pubmed|31420537]
inactivation of [gene|CCDDC414E266D86B9027EA67EA565D87357023B3|ndhF] facilitates the adaptation a strain lacking c-di-AMP to growth on medium containing glutamate [pubmed|33481774]
The protein
Catalyzed reaction/ biological activity
uptake of bicarbonate (with [protein|E04C67FB0EA3FFEC8FB68440F4661505C3DFDA29|MpsB]) [pubmed|34287032]
Protein family
complex I subunit 5 family (single member, according to UniProt)
[wiki|Cofactors]
FMN or FAD [Pubmed|21635694]
Structure
[PDB|4HE8] (from Thermus thermophilus, corresponds to aa 70 ... 352, 28.% identity) [pubmed|23417064]
[AF|P39755]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|CCDDC414E266D86B9027EA67EA565D87357023B3|ndhF]-[gene|E04C67FB0EA3FFEC8FB68440F4661505C3DFDA29|ybcC]-[gene|5D96DF2F32050BBCEC3811843398FE84DE88F6DF|ybcF]-[gene|EBE0360D89E50EEBB84CC853C6E4B4053DBF8925|ybcH]-[gene|6E063903E9E3B770CAACA9DF98DFA540FAE6FD3D|ybcI]
description
[Pubmed|22383849]
Open in new tab

[gene|CCDDC414E266D86B9027EA67EA565D87357023B3|ndhF]→[gene|6E063903E9E3B770CAACA9DF98DFA540FAE6FD3D|ybcI]

2022-12-01 03:35:00

Jstuelk

38

e140e954b90890d3138431566447fb6e0403ad92

FF8650333154CD6783C7E2C33588F0F5E9F40953

additional information
highly expressed at high iron concentrations [pubmed|31420537]
Biological materials
Mutant
BKE01830 (Δ[gene|CCDDC414E266D86B9027EA67EA565D87357023B3|ndhF]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE01830 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCTAAATTCTCCCTTTT,  downstream forward: _UP4_ATTTCATAAGGAGCTAATCT
BKK01830 (Δ[gene|CCDDC414E266D86B9027EA67EA565D87357023B3|ndhF]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK01830 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCTAAATTCTCCCTTTT,  downstream forward: _UP4_ATTTCATAAGGAGCTAATCT
References
18763711,31420537,23417064,33481774,25448817,31399577,34287032,34730408

CCDDC414E266D86B9027EA67EA565D87357023B3

Page visits: 2858

Time of last update: 2022-12-01 09:13:06

Author of last update: Jstuelk