lethal when synthesized during vegetative growth in the absence of [protein|6C9F403D67CDC2EE66C534B0F23D973E24C9A089|spoIISB]

Molecular weight
28.91 kDa
Protein length
Gene length
programmed cell death
spoIISA, ykaC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

1,348,612 → 1,349,358
Visit Sartorius.com Visit Sartorius.com
The protein
Protein family
SpoIISA toxin family (single member, according to UniProt)
three putative membrane-spanning segments and a cytoplasmic domain
[PDB|3O6Q] (cytoplasmic fragment of [protein|CD14C88E9976964A0D25BAA22C395A5A6951654D|spoIISA] (CSpoIISA) in complex with [protein|6C9F403D67CDC2EE66C534B0F23D973E24C9A089|spoIISB]) [Pubmed|21147767]
cell membrane [Pubmed|20863891]
Expression and Regulation
sigma factors
[protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK]: sigma factor, in [regulon|protein:24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK regulon]
Open in new tab


2024-04-19 06:50:20





Biological materials
MGNA-A006 (spoIISA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/6 NBRP B. subtilis, Japan]
1S123 ( ''spoIISA''::''kan''), [Pubmed|11371520], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S123&Search=1S123 BGSC]
BKE12830 (Δ[gene|CD14C88E9976964A0D25BAA22C395A5A6951654D|spoIISA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE12830 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTCGAATCCCTCACAT,  downstream forward: _UP4_ATTGAGGAGGAAGGTGAAGG
BKK12830 (Δ[gene|CD14C88E9976964A0D25BAA22C395A5A6951654D|spoIISA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK12830 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTCGAATCCCTCACAT,  downstream forward: _UP4_ATTGAGGAGGAAGGTGAAGG
Original Publications


Page visits: 2404

Time of last update: 2024-04-23 06:09:00

Author of last update: Melvin.boenninger