spoIISA

spoIISA
168

lethal when synthesized during vegetative growth in the absence of [protein|6C9F403D67CDC2EE66C534B0F23D973E24C9A089|spoIISB]

locus
BSU_12830
Molecular weight
28.91 kDa
pI
4.68
Protein length
Gene length
function
programmed cell death
product
toxin
essential
no
synonyms
spoIISA, ykaC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
1,348,612 → 1,349,358
The protein
Protein family
SpoIISA toxin family (single member, according to UniProt)
[wiki|Domains]
three putative membrane-spanning segments and a cytoplasmic domain
Structure
[PDB|3O6Q] (cytoplasmic fragment of [protein|CD14C88E9976964A0D25BAA22C395A5A6951654D|spoIISA] (CSpoIISA) in complex with [protein|6C9F403D67CDC2EE66C534B0F23D973E24C9A089|spoIISB]) [Pubmed|21147767]
[AF|O34853]
[wiki|Localization]
cell membrane [Pubmed|20863891]
Expression and Regulation
Operons
genes
[gene|CD14C88E9976964A0D25BAA22C395A5A6951654D|spoIISA]-[gene|6C9F403D67CDC2EE66C534B0F23D973E24C9A089|spoIISB]
description
[Pubmed|11371520]
sigma factors
[protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK]: sigma factor, in [regulon|protein:24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK regulon]
Open in new tab

[gene|CD14C88E9976964A0D25BAA22C395A5A6951654D|spoIISA]→[gene|6C9F403D67CDC2EE66C534B0F23D973E24C9A089|spoIISB]

2022-11-22 13:03:54

ghost

32

dba0540459879cc4ec595c8048a437eb0a18061d

5789610C653201DDB59376F461D88F12DF191D72

Biological materials
Mutant
MGNA-A006 (spoIISA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/6 NBRP B. subtilis, Japan]
1S123 ( ''spoIISA''::''kan''), [Pubmed|11371520], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S123&Search=1S123 BGSC]
BKE12830 (Δ[gene|CD14C88E9976964A0D25BAA22C395A5A6951654D|spoIISA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE12830 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTCGAATCCCTCACAT,  downstream forward: _UP4_ATTGAGGAGGAAGGTGAAGG
BKK12830 (Δ[gene|CD14C88E9976964A0D25BAA22C395A5A6951654D|spoIISA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK12830 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTCGAATCCCTCACAT,  downstream forward: _UP4_ATTGAGGAGGAAGGTGAAGG
References
Reviews
31075979
Original Publications
18096016,11371520,21147767,25039482,20863891,26300872,27294956

CD14C88E9976964A0D25BAA22C395A5A6951654D

Page visits: 1690

Time of last update: 2022-11-30 06:48:05

Author of last update: Melvin.boenninger