ureC

ureC
168

urease (alpha subunit)

locus
BSU_36640
Molecular weight
61.01 kDa
pI
5.09
Protein length
Gene length
function
utilization of urea as alternative nitrogen source
product
urease (alpha subunit)
essential
no
ec
3.5.1.5
synonyms
ureC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0804

This gene is a member of the following regulons

Gene
Coordinates
3,766,714 → 3,768,423
The protein
Catalyzed reaction/ biological activity
2 H+ + H2O + urea --> CO2 + 2 NH4+ (according to UniProt)
Protein family
[wiki|Metallo-dependent hydrolases superfamily] (according to UniProt)
[wiki|Domains]
Urease domain (aa 132-569) (according to UniProt)
[wiki|Cofactors]
nickel
Structure
[PDB|5A6T] (from Sporosarcina pasteurii, 65% identity) [pubmed|26580226]
[AF|P77837]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|63CF8C8BBCE39BD585DD5F6C8BBD95E12B500AE6|ywzF]-[gene|1D9596609AEF10456041918BD592E49466D93B1F|ywzE]-[gene|57B6D70B2570C308377B301EC2AF6C232233FD46|ureA]-[gene|B1559A1482B1F5932E6F77B32BF87E7474E01C17|ureB]-[gene|CD3DD65D6EFF11564088CA8D56640F772DEAC2D9|ureC]
description
[Pubmed|22383849]
Open in new tab

[gene|63CF8C8BBCE39BD585DD5F6C8BBD95E12B500AE6|ywzF]→[gene|CD3DD65D6EFF11564088CA8D56640F772DEAC2D9|ureC]

2022-11-24 09:28:16

Jstuelk

42

3a346978aa36c52246d401910c25c973229ebcd4

2EC7A375287DC2C117653A7AF0CE944D5ED3C17E

genes
[gene|57B6D70B2570C308377B301EC2AF6C232233FD46|ureA]-[gene|B1559A1482B1F5932E6F77B32BF87E7474E01C17|ureB]-[gene|CD3DD65D6EFF11564088CA8D56640F772DEAC2D9|ureC]
description
[Pubmed|9287005]
regulation
induced by nitrogen limitation ([protein|search|GlnR], [protein|search|TnrA]) [Pubmed|9287005]
regulatory mechanism
[protein|641C4BDD9702804642E1753A9C779E80FABB3919|glnR]: repression, [Pubmed|9287005], in [regulon|protein:641C4BDD9702804642E1753A9C779E80FABB3919|glnR regulon]
[protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA]: activation, [Pubmed|9287005], in [regulon|protein:857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA regulon]
[protein|52C1601482C26400A524E880334BB801F832D6ED|pucR]: activation, [Pubmed|12374841], in [regulon|protein:52C1601482C26400A524E880334BB801F832D6ED|pucR regulon]
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|9287005,12618455], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|9287005], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH]: sigma factor, [Pubmed|9287005], in [regulon|protein:DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH regulon]
Open in new tab

[gene|57B6D70B2570C308377B301EC2AF6C232233FD46|ureA]→[gene|CD3DD65D6EFF11564088CA8D56640F772DEAC2D9|ureC]

2022-11-23 04:19:25

ghost

26

2424bd660c3e7e5f26264d885ccc1b3206a82722

869154A4A6E14A6F76FB429E5FEE8D2B62E5A9F8

Biological materials
Mutant
GP3982 (Δ[gene|CD3DD65D6EFF11564088CA8D56640F772DEAC2D9|ureC]::aphA3 trpC2), available in [wiki|Jörg Stülke]'s lab
BKE36640 (Δ[gene|CD3DD65D6EFF11564088CA8D56640F772DEAC2D9|ureC]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE36640 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CGCATATTCCTCCCGTGACA,  downstream forward: _UP4_TGATAAGACGCGGCCGGAGT
BKK36640 (Δ[gene|CD3DD65D6EFF11564088CA8D56640F772DEAC2D9|ureC]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK36640 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CGCATATTCCTCCCGTGACA,  downstream forward: _UP4_TGATAAGACGCGGCCGGAGT
Expression vectors
pGP3760: expression of Strep-''ureC'' by [wiki|pGP380] in ''B. subtilis'' suitable for [wiki|SPINE], available in [wiki|Jörg Stülke]'s lab
References
Reviews
23539618,19363030
Original Publications
12618455,16199586,9287005,9287005,12374841,9287005,25755103,26580226

CD3DD65D6EFF11564088CA8D56640F772DEAC2D9

Page visits: 1715

Time of last update: 2022-11-28 14:20:16

Author of last update: Robert.warneke