SubtiWiki SubtiWiki
yhjA

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yhjA
168

unknown

locus
BSU_10440
Molecular weight
9.66 kDa
pI
10.39
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yhjA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
1,118,850 → 1,119,119
Expression and Regulation
Operons
genes
[gene|CDD43B0BE83CD5C43D804620A3CF76BCDC8077DE|yhjA]
description
[Pubmed|22383849]
Open in new tab

[gene|CDD43B0BE83CD5C43D804620A3CF76BCDC8077DE|yhjA]

2020-11-06 12:56:32

Jstuelk

0

17742a9c0958ede659aac9d4ff386ea73f85ae16

52B2C4F7AE086652B1E48FB0277BA58020C65CC4

Biological materials
Mutant
BKE10440 (Δ[gene|CDD43B0BE83CD5C43D804620A3CF76BCDC8077DE|yhjA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10440 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGACGATTCACTCTCCCA,  downstream forward: _UP4_TAAATAAGAAAAAGCAATCT
BKK10440 (Δ[gene|CDD43B0BE83CD5C43D804620A3CF76BCDC8077DE|yhjA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10440 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGACGATTCACTCTCCCA,  downstream forward: _UP4_TAAATAAGAAAAAGCAATCT

CDD43B0BE83CD5C43D804620A3CF76BCDC8077DE

Page visits: 680

Time of last update: 2022-01-23 07:39:35

Author of last update: Bzhu