SubtiWiki SubtiWiki
aapA
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

aapA
168

amino acid permease

locus
BSU_27090
Molecular weight
50.49 kDa
pI
9.68
Protein length
Gene length
function
amino acid uptake
product
amino acid permease
essential
no
synonyms
aapA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1113

This gene is a member of the following regulons

Gene
Coordinates
2,766,558 → 2,767,946
The protein
Protein family
[wiki|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt)
Structure
[PDB|3NCY] (from Salmonella typhimurium, 21% identity) [pubmed|19578361]
Paralogous protein(s)
[protein|1594BA83CED2DA9F86C1CE2A0DC6E1C9B665EACB|gabP], [protein|219586A3F378DC38EA076FD39B99D41136BDE722|alaP], [protein|423AEC9D260BE53AD22851D999244B89BEB3E84D|hutM], [protein|8C4A8961B2514A8AD531AFB104B10C0797D02AC2|yvbW], [protein|9AD0E43119BDC65D5F67CE55CD9417E1E6BAE058|ybxG], [protein|9BFB16C12B31ABD70BBB921BCB9E4201E3BDC92D|rocC], [protein|B46A8BCEC56E6252712E30F8BF8DA6B836FDE2F6|rocE], [protein|B6A920650919D5BBBD75CCA58C30A0D8ECE64DA3|ybgF], [protein|C7FEA1D9C7C96C39CEE83CE3F13D412DE6AFE10E|ydgF]
Expression and Regulation
Operons
genes
[gene|CE4A49F5CCC2D36C5CE5AD7AE7F0A70F2D4F425C|aapA]
description
[Pubmed|22383849]
Open in new tab

[gene|CE4A49F5CCC2D36C5CE5AD7AE7F0A70F2D4F425C|aapA]

2021-09-18 05:53:05

Jstuelk

6

b2bce8676455897f7dafdcba1ca5071a38942c1d

BDCE16B71DFB22BFCC6F9D7100051E5A6F7D4C0E

Biological materials
Mutant
GP2377 Δ''[gene|CE4A49F5CCC2D36C5CE5AD7AE7F0A70F2D4F425C|aapA]''::''tet'', available in [wiki|Jörg Stülke]'s lab [pubmed|32743959]
MGNA-A230 (aapA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/230 NBRP B. subtilis, Japan]
BKE27090 (Δ[gene|CE4A49F5CCC2D36C5CE5AD7AE7F0A70F2D4F425C|aapA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27090 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATTTTATTTTCCTCCAGT,  downstream forward: _UP4_TAAAAAAAAGACAAGGGATA
BKK27090 (Δ[gene|CE4A49F5CCC2D36C5CE5AD7AE7F0A70F2D4F425C|aapA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27090 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATTTTATTTTCCTCCAGT,  downstream forward: _UP4_TAAAAAAAAGACAAGGGATA
lacZ fusion
pGP2273 (in [wiki|pAC5]) (GP2960), available in [wiki|Jörg Stülke]'s lab
References
Research papers
19578361

CE4A49F5CCC2D36C5CE5AD7AE7F0A70F2D4F425C

Page visits: 1000

Time of last update: 2021-09-23 06:09:03

Author of last update: Jstuelk