SubtiWiki SubtiWiki
aapA

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

aapA
168

amino acid permease

locus
BSU_27090
Molecular weight
50.49 kDa
pI
9.68
Protein length
Gene length
function
amino acid uptake
product
amino acid permease
essential
no
synonyms
aapA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1113

This gene is a member of the following regulons

Gene
Coordinates
2,766,558 → 2,767,946
The protein
Protein family
[wiki|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt)
Structure
[PDB|7CCS] (human protein, corresponds to aa 6 ... 420, 25% identity) [pubmed|33016372]
Paralogous protein(s)
[protein|1594BA83CED2DA9F86C1CE2A0DC6E1C9B665EACB|gabP], [protein|219586A3F378DC38EA076FD39B99D41136BDE722|alaP], [protein|423AEC9D260BE53AD22851D999244B89BEB3E84D|hutM], [protein|8C4A8961B2514A8AD531AFB104B10C0797D02AC2|yvbW], [protein|9AD0E43119BDC65D5F67CE55CD9417E1E6BAE058|ybxG], [protein|9BFB16C12B31ABD70BBB921BCB9E4201E3BDC92D|rocC], [protein|B46A8BCEC56E6252712E30F8BF8DA6B836FDE2F6|rocE], [protein|B6A920650919D5BBBD75CCA58C30A0D8ECE64DA3|ybgF], [protein|C7FEA1D9C7C96C39CEE83CE3F13D412DE6AFE10E|ydgF]
Expression and Regulation
Operons
genes
[gene|CE4A49F5CCC2D36C5CE5AD7AE7F0A70F2D4F425C|aapA]
description
[Pubmed|22383849]
Open in new tab

[gene|CE4A49F5CCC2D36C5CE5AD7AE7F0A70F2D4F425C|aapA]

2022-01-25 11:08:31

Jstuelk

14

b2bce8676455897f7dafdcba1ca5071a38942c1d

BDCE16B71DFB22BFCC6F9D7100051E5A6F7D4C0E

Biological materials
Mutant
GP2377 Δ''[gene|CE4A49F5CCC2D36C5CE5AD7AE7F0A70F2D4F425C|aapA]''::''tet'', available in [wiki|Jörg Stülke]'s lab [pubmed|32743959]
MGNA-A230 (aapA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/230 NBRP B. subtilis, Japan]
BKE27090 (Δ[gene|CE4A49F5CCC2D36C5CE5AD7AE7F0A70F2D4F425C|aapA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27090 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATTTTATTTTCCTCCAGT,  downstream forward: _UP4_TAAAAAAAAGACAAGGGATA
BKK27090 (Δ[gene|CE4A49F5CCC2D36C5CE5AD7AE7F0A70F2D4F425C|aapA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27090 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATTTTATTTTCCTCCAGT,  downstream forward: _UP4_TAAAAAAAAGACAAGGGATA
lacZ fusion
pGP2273 (in [wiki|pAC5]) (GP2960), available in [wiki|Jörg Stülke]'s lab
References
Research papers
19578361,33016372

CE4A49F5CCC2D36C5CE5AD7AE7F0A70F2D4F425C

Page visits: 1053

Time of last update: 2022-01-28 17:09:57

Author of last update: Jstuelk