pksA

At Gram+ 2022 in Prague, there will be a workshop on how to get the most out of SubtiWiki. We will present newly added features. Moreover, we hope to learn from you what you would like to have added to SubtiWiki to improve it!

pksA
168

transcriptional regulator ([wiki|TetR family]), not involved in the regulation of the pks operon!

locus
BSU_17080
Molecular weight
23.59 kDa
pI
6.44
Protein length
Gene length
function
unknown
product
transcriptional regulator ([wiki|TetR family])
essential
no
synonyms
pksA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3226

This gene is a member of the following regulons

Gene
Coordinates
1,781,906 → 1,782,523
The protein
Protein family
[wiki|TetR family]
[wiki|Domains]
[wiki|HTH tetR-type domain] (aa 8-68) (according to UniProt)
Structure
[PDB|2NX4] (from Rhodococcus sp., 28% identity)
[AF|O34381]
Biological materials
Mutant
BKE17080 (Δ[gene|CE5C1631A4D29FC195829FCC7961A687581698D6|pksA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17080 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGCTTTATTGTAACAAG,  downstream forward: _UP4_TAAGGCACTAGTGTGAAAAG
BKK17080 (Δ[gene|CE5C1631A4D29FC195829FCC7961A687581698D6|pksA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17080 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGCTTTATTGTAACAAG,  downstream forward: _UP4_TAAGGCACTAGTGTGAAAAG
References
Reviews
24006471
Original Publications
24187085

CE5C1631A4D29FC195829FCC7961A687581698D6

Page visits: 903

Time of last update: 2022-05-20 00:09:33

Author of last update: Melvin.boenninger