SubtiWiki SubtiWiki
yfhH

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yfhH
168

unknown

locus
BSU_08530
Molecular weight
11.87 kDa
pI
4.62
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yfhH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
926,429 → 926,743
The protein
Structure
[PDB|1SF9]
Expression and Regulation
Operons
genes
[gene|144E7D10740C5F146403612B8A0C88E02FB9C572|recX]-[gene|CEB1A0835C26E14E04BA99F933787C4550A96388|yfhH]
description
[Pubmed|22383849]
Open in new tab

[gene|144E7D10740C5F146403612B8A0C88E02FB9C572|recX]→[gene|CEB1A0835C26E14E04BA99F933787C4550A96388|yfhH]

2021-12-20 10:15:18

ghost

5

5b6a385ee43aaac4edfea85d0c0679b53a109b6a

E4A7EA8284350823BE195BBA357E25294134B7CF

Biological materials
Mutant
MGNA-C316 (yfhH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2314 NBRP B. subtilis, Japan]
BKE08530 (Δ[gene|CEB1A0835C26E14E04BA99F933787C4550A96388|yfhH]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08530 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTGACTGTATCGTTTCT,  downstream forward: _UP4_TAAAGCGTAACAGGAGGCTG
BKK08530 (Δ[gene|CEB1A0835C26E14E04BA99F933787C4550A96388|yfhH]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08530 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTGACTGTATCGTTTCT,  downstream forward: _UP4_TAAAGCGTAACAGGAGGCTG
References
22383849

CEB1A0835C26E14E04BA99F933787C4550A96388

Page visits: 1197

Time of last update: 2022-01-23 14:02:33

Author of last update: Bzhu