rel

rel
168

GTP pyrophosphokinase (stringent response regulon)

locus
BSU_27600
Molecular weight
84.65 kDa
pI
6.96
Protein length
Gene length
function
synthesis and degradation of (p)ppGpp, triggering the stringent response regulon
product
GTP pyrophosphokinase
essential
no
ec
2.7.6.5
synonyms
relA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0317

This gene is a member of the following regulons

Gene
Coordinates
2,820,529 → 2,822,733
Phenotypes of a mutant
requirement for valine [Pubmed|24163341]
a [gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|rel] [gene|1107A963C253FBEE8716507BD0EC0E7CD5642B12|sasA] [gene|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|sasB] triple mutant requires branched chain amino acids, methionine and threonine for growth, the requirement can be suppressed by reduced expression of [gene|AB3D18228DB6819B0C81BC7A8BB3408A4F75DC0C|guaB] or inactivation of [gene|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY] [Pubmed|24163341]
a [gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|rel] [gene|1107A963C253FBEE8716507BD0EC0E7CD5642B12|sasA] [gene|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|sasB] triple mutant acquires suppressor mutations in [gene|AC67305E4C165CC1D785E49B7CD8335346134376|guaA], [gene|AB3D18228DB6819B0C81BC7A8BB3408A4F75DC0C|guaB], [gene|1BC994DE60A7BB35DEDD7154581A396D29AA94A7|gmk] or inactivation of [gene|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY] [Pubmed|24682323,24163341]
mutation in [gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|rel] results in increased motility and chaining via elevated [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD] level  [Pubmed|25331430]
The protein
Catalyzed reaction/ biological activity
ATP + GTP --> AMP + guanosine 3'-diphosphate 5'-triphosphate (according to UniProt)
Protein family
RelA/SpoT family (with [protein|1107A963C253FBEE8716507BD0EC0E7CD5642B12|sasA] and [protein|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|sasB], according to UniProt)
[wiki|Domains]
N-terminal ppGpp hydrolase domain ([wiki|HD domain]) (aa 31-180) [Pubmed|24163341]
central ppGpp synthetase domain [Pubmed|24163341]
[wiki|TGS domain] (aa 392-453) (according to UniProt)
C-terminal [wiki|ACT domain] (aa 660-734) (responsible for fine-tuning of activation at the ribosome) [pubmed|32184768]
Structure
[PDB|6YXA] (aa 1 ... 556) [pubmed|32937119]
[PDB|6HTQ] (the [protein|CEE73284EFC0DBE8870CE0B474922DED79475A57|rel]-[wiki|ribosome] complex) [pubmed|32937119]
[PDB|1VJ7] (N-terminal catalytic fragment, from ''Streptococcus equisimilis'', 60% identity) [Pubmed|15066282]
[AF|O54408]
Effectors of protein activity
(p)ppGpp synthesis is activated by uncharged tRNAs in a ribosome-dependent manner [pubmed|33330919]
synthetase activity of RelA is activated by pppGpp binding to an allosteric site in the NTD region [pubmed|33330919]
hydrolase activity of ReAl is inhibited by (p)ppGpp [pubmed|34416138]
the interaction with [protein|41DFEF8A6BC7E34A6681C26D92F2B08DC120A957|comGA] inhibits the hydrolysis of ppGpp [Pubmed|25899641]
heat stress triggers (p)ppGpp synthesis [pubmed|32176689]
the presence of immature tRNAs due to depletion of [protein|594F2D36BE71A45303A33AA2A2931F56F0A969ED|RNase P] or [protein|C40C5D35ED53D343C8200248FCCB010BAB388054|RNase Z] triggers (p)ppGpp synthesis by [protein|CEE73284EFC0DBE8870CE0B474922DED79475A57|rel] [pubmed|31003868]
interaction with apo-[protein|90AFF93D6E7BC993B2773C12EE400C80A87A4831|darB] (under conditions of potassium starvation) triggers (p)ppGpp synthesis and inhibits (p)ppGpp hydrolysis [pubmed|33619274]
Expression and Regulation
Operons
genes
[gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|rel]-[gene|860F8A7D054BF483D43B4659732F5A6D30DACBD9|dtd]
description
[Pubmed|9383190]
Open in new tab

[gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|rel]→[gene|860F8A7D054BF483D43B4659732F5A6D30DACBD9|dtd]

2022-09-25 08:57:10

ghost

33

7fb856c2e6ff2d9f5d93b5e8a011814bac480391

9BB1F2AB2B529AE2E3EB57A7D15916559B86340F

Biological materials
Mutant
[gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|rel] mutant [Pubmed|9383190] - note that [gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|rel] mutants are prone to suppressor mutations in the [gene|1107A963C253FBEE8716507BD0EC0E7CD5642B12|sasA] or [gene|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|sasB] loci [Pubmed|18670626]
GP2066 ([gene|1107A963C253FBEE8716507BD0EC0E7CD5642B12|sasA] [gene|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|sasB] [gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|rel]::mls), available in [wiki|Jörg Stülke]'s lab
BKE27600 (Δ[gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|rel]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE27600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGAATCACCTTTTTTAA, downstream forward: _UP4_TAAAGGGGTTAGAAAAGAGA
BKK27600 (Δ[gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|rel]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK27600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGAATCACCTTTTTTAA, downstream forward: _UP4_TAAAGGGGTTAGAAAAGAGA
GP3419 (Δ[gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|rel]::cat) , available in [wiki|Jörg Stülke]'s lab
GP3471 (Δ[gene|1107A963C253FBEE8716507BD0EC0E7CD5642B12|sasA]::spec Δ[gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|rel]::cat), available in [wiki|Jörg Stülke]'s lab
GP3472 (Δ[gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|rel]::cat Δ[gene|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|sasB]::phleo), available in [wiki|Jörg Stülke]'s lab
GP3429 ([gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|rel]-6xHis-cat), available in [wiki|Jörg Stülke]'s lab
Expression vectors
pGP3330 (N-terminal 6xHis-tag, purification from E. coli, in [wiki|pWH844]), available in [wiki|Jörg Stülke]'s lab
pGP3459 (N-terminal 6xHis-SUMO-tag, purification from E. coli, in pET-SUMO), available in [wiki|Jörg Stülke]'s lab
pGP3348 (N-terminal Strep-tag, purification from E. coli, in [wiki|pGP172]), available in [wiki|Jörg Stülke]'s lab
pGP3350 (aa 1-391) (N-terminal Strep-tag, purification from E. coli, in [wiki|pGP172]), available in [wiki|Jörg Stülke]'s lab
pGP3430: expression of Strep-[gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|rel] by [wiki|pGP380] in B. subtilis suitable for [wiki|SPINE], available in [wiki|Jörg Stülke]'s lab
pGP3431: expression of [gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|rel]-Strep by [wiki|pGP382] in B. subtilis suitable for [wiki|SPINE], available in [wiki|Jörg Stülke]'s lab
two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jörg Stülke]'s lab
labs
[wiki|Jade Wang], University of Wisconsin–Madison [https://bact.wisc.edu/people_profile.php?t=rf&p=jdwang2 homepage]
References
Reviews
27149325,30980074,34343020,25853779
Original Publications
25331430,9383190,10209741,24489751,19447912,13129942,12372825,12081964,11948165,12419222,23028324,24163341,24682323,25899641,15066282,27775002,27875634,31003868,15066282,32176689,32184768,31003868,32393900,32937119,33330919,33619274,34416138,35594298,35714772,36053906

CEE73284EFC0DBE8870CE0B474922DED79475A57

Page visits: 9025

Time of last update: 2022-10-03 08:51:46

Author of last update: Jstuelk