yuzA

yuzA
168

general stress protein

locus
BSU_31380
Molecular weight
8.33 kDa
pI
6.41
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yuzA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2155

This gene is a member of the following regulons

Gene
Coordinates
3,224,864 → 3,225,100
The protein
Structure
[AF|O32087]
Expression and Regulation
Operons
genes
[gene|CEF2AA772D85DEFB4F43394C75E49E90A462097E|yuzA]
description
[Pubmed|16497325]
regulation
expressed during sporulation in the forespore ([protein|search|SigG]) [Pubmed|16497325]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|15699190,16497325], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|11544224], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|CEF2AA772D85DEFB4F43394C75E49E90A462097E|yuzA]

2022-12-10 12:17:24

ghost

13

a04530d897a1681ea4cbc9cebe1ed84c4a65daee

FFFB23ABFED1B7E9B50598E99360FEAB9E074DAD

additional information
the mRNA belongs to the 46 most abundant mRNA species in dormant spores [pubmed|30782632]
Biological materials
Mutant
BKE31380 (Δ[gene|CEF2AA772D85DEFB4F43394C75E49E90A462097E|yuzA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE31380 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTTTGCAACCTCCTCC,  downstream forward: _UP4_TAGGATATCAATCACGCTGA
BKK31380 (Δ[gene|CEF2AA772D85DEFB4F43394C75E49E90A462097E|yuzA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK31380 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTTTGCAACCTCCTCC,  downstream forward: _UP4_TAGGATATCAATCACGCTGA
References
11544224,15699190,16497325,30782632

CEF2AA772D85DEFB4F43394C75E49E90A462097E

Page visits: 1533

Time of last update: 2023-02-05 02:29:16

Author of last update: Jstuelk