sigF

sigF
168

[wiki|RNA polymerase] forespore-specific (early) [wiki|sigma factor] SigF

locus
BSU_23450
Molecular weight
29.22 kDa
pI
5.08
Protein length
Gene length
function
transcription of [wiki|sporulation] genes (early forespore)
product
[wiki|RNA polymerase] forespore-specific (early) [wiki|sigma factor] SigF
essential
no
synonyms
sigF, spoIIAC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1191

This gene is a member of the following regulons

Gene
Coordinates
2,443,429 → 2,444,196
The protein
Protein family
[wiki|Sigma-70 factor family] (according to UniProt)
Structure
[PDB|1L0O] (complex with [protein|C8B867758330355F44C63CC284DC7AA3061FB9F1|spoIIAB], Geobacillus stearothermophilus) [pubmed|11955433]
[AF|P07860]
Paralogous protein(s)
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]
Expression and Regulation
Operons
genes
[gene|3936E91C062074BFE4284B54A8CC33F35F94F5EE|spoIIAA]-[gene|C8B867758330355F44C63CC284DC7AA3061FB9F1|spoIIAB]-[gene|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]
description
[Pubmed|22383849]
regulation
''[wiki|spoIIAA]'': expressed early during sporulation
regulatory mechanism
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]: activation, [PubMed|1556084,15687200], in [regulon|protein:2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]: repression, in [regulon|protein:5A6FBAE6553343092862CB79E150F934978C32A9|sinR regulon]
sigma factors
[protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]: sigma factor, in [regulon|protein:CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF regulon]
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
[protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH]: sigma factor, in [regulon|protein:DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH regulon]
Open in new tab

[gene|3936E91C062074BFE4284B54A8CC33F35F94F5EE|spoIIAA]→[gene|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]

2023-01-25 05:05:10

ghost

50

64b4f19f43ec57e308620c649e41be0eaadae6be

781B7F1839769E51F61804AF186C6D2AF7A0DA95

genes
[gene|F7AD78F9AB98A150E8CDFC1D01A9F938FF9F8BD1|dacF]-[gene|3936E91C062074BFE4284B54A8CC33F35F94F5EE|spoIIAA]-[gene|C8B867758330355F44C63CC284DC7AA3061FB9F1|spoIIAB]-[gene|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]
description
[Pubmed|22383849]
regulation
''[wiki|spoIIAA]'': expressed early during sporulation
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]: sigma factor, [Pubmed|15699190], in [regulon|protein:CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF regulon]
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|F7AD78F9AB98A150E8CDFC1D01A9F938FF9F8BD1|dacF]→[gene|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]

2023-02-06 13:36:47

ghost

60

3937ee398a65a809f372c4c59231b1d2e3c32629

AEBA18A2591E8C2953E0D2D62B0F6CD480E5CB2B

Biological materials
Mutant
BKE23450 (Δ[gene|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE23450 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CTCCACATCCATAACAAATC,  downstream forward: _UP4_TAGTCTGCAGTGCAGGCTAG
BKK23450 (Δ[gene|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK23450 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CTCCACATCCATAACAAATC,  downstream forward: _UP4_TAGTCTGCAGTGCAGGCTAG
labs
[wiki|Charles Moran], Emory University, NC, USA [http://www.microbiology.emory.edu/moran_c.html homepage]
References
Reviews
20833318,31350897,35638784
Original Publications
10503549,8358793,7570023,9555886,3007937,8460142,9077448,10323866,10869437,7768847,14744853,8759874,10864495,1744043,16824103,11701124,1902463,8171000,1904527,15351644,15882622,8764398,8764397,9826498,9826499,2492512,1629150,12676949,7592342,11684022,8846916,1948031,8126438,3114419,12081956,9150232,15205443,9004507,8168129,2123551,8824593,19390092,17498739,8021191,1556084,15687200,12107147,18208527,10049355,23169620,21037003,20817675,21935351,25101664,11955433,28838935,29702640
The [wiki|SigF regulon]
16497325,26506528

CFF318EE6CACDEE763FBF96A2ABB46E944679AAA

Page visits: 9617

Time of last update: 2023-02-06 18:19:49

Author of last update: Jstuelk