SubtiWiki SubtiWiki
ahpC
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ahpC
168

alkyl hydroperoxide reductase (small subunit)

locus
BSU_40090
Molecular weight
20.48 kDa
pI
4.28
Protein length
Gene length
function
resistance against peroxide stres
product
alkyl hydroperoxide reductase (small subunit)
essential
no
ec
1.11.1.15
synonyms
ahpC, perR

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0450

This gene is a member of the following regulons

Gene
Coordinates
4,118,950 4,119,513
The protein
Catalyzed reaction/ biological activity
[protein]-dithiol + hydroperoxide --> [protein]-disulfide + alcohol + H2O (according to UniProt)
Protein family
[wiki|peroxiredoxin family] (according to UniProt)
[wiki|Domains]
[wiki|Thioredoxin domain] (aa 2-157) (according to UniProt)
Structure
[PDB|1WE0] (from ''Amphibacillus xylanus'', 78% identity, 88% similarity) [Pubmed|15770647]
Modification
phosphorylated on ser/ thr/ tyr [Pubmed|16493705]
CoA is attached to Cys-166 in spores [pubmed|33206970]
Paralogous protein(s)
[protein|B283B702D917E310130BC33A40BF6A5853C3D4C1|ahpA]
Additional information
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|D0982500E52577D52FADF775C0E512A4B9657B79|ahpC]-[gene|8F23B575BC32EA63267C4321DD8E4BD546B11AF1|ahpF]
description
[Pubmed|8932314]
regulation
induced by H2O2 ([protein|search|PerR]) [Pubmed|11532148]
regulatory mechanism
[protein|00BCAAE16576DC5426A652580C69A570FC7A1C2C|perR]: repression, [Pubmed|11532148], in [regulon|protein:00BCAAE16576DC5426A652580C69A570FC7A1C2C|perR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8932314], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|D0982500E52577D52FADF775C0E512A4B9657B79|ahpC]→[gene|8F23B575BC32EA63267C4321DD8E4BD546B11AF1|ahpF]

2021-09-18 05:53:17

ghost

7

faf2593fbfc50585279e38e62b17a9a5b60cff9f

9798B313F3B383CB7131D3E1F8AD0DA2D1B1888C

Biological materials
Mutant
GP1730 [gene|search|ahpCF]::mls trpC2 available at Jrg Stlkes lab
BKE40090 ([gene|D0982500E52577D52FADF775C0E512A4B9657B79|ahpC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATGTATATTCCTCCTA, downstream forward: _UP4_GGTAAAATCTAAGGAGTGCA
BKK40090 ([gene|D0982500E52577D52FADF775C0E512A4B9657B79|ahpC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATGTATATTCCTCCTA, downstream forward: _UP4_GGTAAAATCTAAGGAGTGCA
References
11532148,15378759,8932314,8932315,16493705,15581580,15770647,33206970

D0982500E52577D52FADF775C0E512A4B9657B79

Page visits: 2527

Time of last update: 2021-09-18 09:34:48

Author of last update: Jstuelk