ycsN

ycsN
168

similar to aryl-alcohol dehydrogenase

locus
BSU_04150
Molecular weight
33.99 kDa
pI
5.28
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ycsN

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG4989

This gene is a member of the following regulons

Gene
Coordinates
466,042 → 466,944
The protein
Protein family
[wiki|Aldo/keto reductase family] (according to UniProt)
[wiki|Aldo/keto reductase 2 subfamily] (according to UniProt)
Structure
[PDB|4R90] (from ''Salmonella Enterica'', 51% identity)
[AF|P42972]
Paralogous protein(s)
[protein|4DF9B105ABA64AFD5106EE75FCC9EFAB52BEFC83|yhdN]
Expression and Regulation
Operons
genes
[gene|5BBA2769A9C0EDB56625F008A55470C2E2885AA4|pbpC]-[gene|D0A2506FDCEA41D2A8910AC2837B46E0B311D63B|ycsN]
description
[Pubmed|22383849]
Open in new tab

[gene|5BBA2769A9C0EDB56625F008A55470C2E2885AA4|pbpC]→[gene|D0A2506FDCEA41D2A8910AC2837B46E0B311D63B|ycsN]

2022-11-26 07:16:05

Jstuelk

27

81abc64fde0e09e8c0327e08184eeaeaa1cd3255

4839481682B4D0CE488465BE6A1CEEDA34EC217C

Biological materials
Mutant
MGNA-C025 (ycsN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2023 NBRP B. subtilis, Japan]
BKE04150 (Δ[gene|D0A2506FDCEA41D2A8910AC2837B46E0B311D63B|ycsN]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE04150 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCAAAATCCCTCTTTTC,  downstream forward: _UP4_TAAAAAGCATCAGTTTACCA
BKK04150 (Δ[gene|D0A2506FDCEA41D2A8910AC2837B46E0B311D63B|ycsN]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK04150 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCAAAATCCCTCTTTTC,  downstream forward: _UP4_TAAAAAGCATCAGTTTACCA

D0A2506FDCEA41D2A8910AC2837B46E0B311D63B

Page visits: 963

Time of last update: 2022-11-28 10:06:21

Author of last update: Melvin.boenninger