ycnJ
Register now for Subtillery 2022, the International Online Meeting on Bacillus subtilis! It will be held from the 19th-22th of September.

ycnJ
168

copper transporter

locus
BSU_03950
Molecular weight
59.64 kDa
pI
10.1
Protein length
Gene length
function
uptake of copper
product
copper transporter
essential
no
ec
null
synonyms
ycnJ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2372

This gene is a member of the following regulons

Gene
Coordinates
446,801 → 448,426
Phenotypes of a mutant
growth-defective under copper-limiting conditions [Pubmed|19168619]
The protein
Catalyzed reaction/ biological activity
uptake of copper [Pubmed|19168619]
Protein family
N-terminal part: CopC family (single member, according to UniProt)
C-terminal part: CopD family (single member, according to UniProt)
Structure
[AF|C0SP95]
[wiki|Localization]
cell membrane [Pubmed|19168619]
Expression and Regulation
Operons
genes
[gene|98D807FBB847BF731B5C236557C8F70347279CE0|ycnK]-[gene|D0F553E661A35C69380ACB01D9A96FC6C5088470|ycnJ]-[gene|1B7F59F954A1F20F75F5D4953F84CE58171741DE|ycnI]
description
[Pubmed|22904286,22383849]
regulation
induced by copper limitation ([protein|search|YcnK]) [Pubmed|22904286,19168619]
regulatory mechanism
[protein|98D807FBB847BF731B5C236557C8F70347279CE0|ycnK]: repression, [Pubmed|22904286,19168619], in [regulon|protein:98D807FBB847BF731B5C236557C8F70347279CE0|ycnK regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|15101989], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|22904286], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|98D807FBB847BF731B5C236557C8F70347279CE0|ycnK]→[gene|1B7F59F954A1F20F75F5D4953F84CE58171741DE|ycnI]

2022-06-27 04:22:04

ghost

17

8c53a82ab33b564f7e085488581f68629ff467ca

7BEB015AF7C4D6403B44178463BB2A5EFEF7821A

Biological materials
Mutant
BKE03950 (Δ[gene|D0F553E661A35C69380ACB01D9A96FC6C5088470|ycnJ]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03950 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCACTCAGACACCACCTT,  downstream forward: _UP4_AAGACCAATTAAGGAGTGTT
BKK03950 (Δ[gene|D0F553E661A35C69380ACB01D9A96FC6C5088470|ycnJ]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03950 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCACTCAGACACCACCTT,  downstream forward: _UP4_AAGACCAATTAAGGAGTGTT
labs
[wiki|Mohamed Marahiel], Marburg University, Germany [http://www.uni-marburg.de/fb15/fachgebiete/bio/marahiel?language_sync=1 homepage]
References
19168619,22904286,22383849

D0F553E661A35C69380ACB01D9A96FC6C5088470

Page visits: 1383

Time of last update: 2022-08-16 09:45:28

Author of last update: Melvin.boenninger