sspL

sspL
168

small acid-soluble spore protein (minor SASP)

locus
BSU_22000
Molecular weight
4.56 kDa
pI
10.31
Protein length
Gene length
function
protection of spore DNA
product
small acid-soluble spore protein (minor SASP)
essential
no
ec
null
synonyms
sspL

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5858

This gene is a member of the following regulons

Gene
Coordinates
2,310,859 → 2,310,987
The protein
Structure
[AF|Q7WY66]
Expression and Regulation
Operons
genes
[gene|D105FCA5F5249A96CC35581D258F78AF82CFEA3B|sspL]
description
[Pubmed|10333516]
regulation
expressed late during sporulation in the forespore ([protein|search|SigG]) [Pubmed|15699190,10333516]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|15699190,10333516], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|D105FCA5F5249A96CC35581D258F78AF82CFEA3B|sspL]

2023-01-06 21:16:18

ghost

11

3cb01a24512029bb169ff46955254e5026ed6414

89A36D134519BD2234108EDF29BA74F97B14E481

Biological materials
Mutant
BKE22000 (Δ[gene|D105FCA5F5249A96CC35581D258F78AF82CFEA3B|sspL]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE22000 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTAGTTCACCTCGCCA,  downstream forward: _UP4_AGCAATACAAAACGCTAGAG
BKK22000 (Δ[gene|D105FCA5F5249A96CC35581D258F78AF82CFEA3B|sspL]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK22000 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTAGTTCACCTCGCCA,  downstream forward: _UP4_AGCAATACAAAACGCTAGAG
References
10333516

D105FCA5F5249A96CC35581D258F78AF82CFEA3B

Page visits: 1023

Time of last update: 2023-02-04 12:31:55

Author of last update: Melvin.boenninger