ppsC

ppsC
168

plipastatin synthetase

locus
BSU_18320
Molecular weight
287.19 kDa
pI
5.35
Protein length
Gene length
function
production of the antibacterial compound plipastatin
product
plipastatin synthetase
essential
no
synonyms
ppsC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG4908

This gene is a member of the following regulons

Gene
Coordinates
1,974,881 → 1,982,548
The protein
Protein family
[wiki|ATP-dependent AMP-binding enzyme family] (according to UniProt)
[wiki|Domains]
2 [wiki|Carrier domain]s (aa 967-1042, aa 2003-2077) (according to UniProt)
Structure
[PDB|2VSQ] (termination module of [protein|1D5F227860A321506A1AB4BAE63CAD3A66E43BFC|srfAC], 37% identity) [pubmed|18583577]
[AF|P39847]
Expression and Regulation
Operons
genes
[gene|E3D7EF8F165CAC2682B0D620081C5C6E555E43C4|ppsA]-[gene|E7A2F93B33B1899313893D362D92405232BC9097|ppsB]-[gene|D11CE89E2AC2ADE3FEFEC261E295EC5906CE6407|ppsC]-[gene|E73D9F1A8F54DAD4B2056CABBE580D7AD36CB042|ppsD]-[gene|C1C051209943E02369356075EAA733297E9478CB|ppsE]
description
[Pubmed|20817675]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
Open in new tab

[gene|E3D7EF8F165CAC2682B0D620081C5C6E555E43C4|ppsA]→[gene|C1C051209943E02369356075EAA733297E9478CB|ppsE]

2022-11-24 21:58:46

ghost

22

c24e95905169206a2bb4f32c2e44eb72392e19bb

53EB981BAF3A634ABF820E4DAD645D458FD52A47

Biological materials
Mutant
BKE18320 (Δ[gene|D11CE89E2AC2ADE3FEFEC261E295EC5906CE6407|ppsC]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE18320 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CTGCGGCATCAGTGAATCTC,  downstream forward: _UP4_TAGAAAATCGTGACAGGAGA
BKK18320 (Δ[gene|D11CE89E2AC2ADE3FEFEC261E295EC5906CE6407|ppsC]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK18320 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CTGCGGCATCAGTGAATCTC,  downstream forward: _UP4_TAGAAAATCGTGACAGGAGA
References
10471562,9387222,21630458,20817675,18583577,29855381

D11CE89E2AC2ADE3FEFEC261E295EC5906CE6407

Page visits: 2320

Time of last update: 2022-12-02 02:59:15

Author of last update: Melvin.boenninger