prpE

prpE
168

protein tyrosine phosphatase

locus
BSU_11630
Molecular weight
27.31 kDa
pI
6.75
Protein length
Gene length
function
unknown
product
protein tyrosine phosphatase
essential
no
ec
3.6.1.17
synonyms
prpE, yjbP

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
1,239,387 → 1,240,121
Phenotypes of a mutant
increased amounts of small aci-soluble spore proteins (SASPs) [Pubmed|21092197]
The protein
Catalyzed reaction/ biological activity
H2O + P1,P4-bis(5'-guanosyl) tetraphosphate --> GMP + GTP + 2 H+ (according to UniProt)
Protein family
prpE family (single member, according to UniProt)
Structure
[PDB|4J6O] (PnkP from Thermocellum sp., 48% identity) [pubmed|23595150]
[AF|O31614]
[wiki|Localization]
forespore (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|D1661093571DA4DEC5FBD8EDD3910879DAFDEE23|prpE]
description
[Pubmed|22383849]
Open in new tab

[gene|D1661093571DA4DEC5FBD8EDD3910879DAFDEE23|prpE]

2022-11-26 14:07:27

ghost

11

2c0251eedea6376dfbcbb4b8da1317879bdc5b54

6C72C0328AC0656B139DE6D18E9E08ECB4A65C3E

Biological materials
Mutant
MGNA-B162 (yjbP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1161 NBRP B. subtilis, Japan]
BKE11630 (Δ[gene|D1661093571DA4DEC5FBD8EDD3910879DAFDEE23|prpE]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE11630 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCGGTCTCCTCCTTACC,  downstream forward: _UP4_CGCCCCATATAAAAAAGGAG
BKK11630 (Δ[gene|D1661093571DA4DEC5FBD8EDD3910879DAFDEE23|prpE]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK11630 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCGGTCTCCTCCTTACC,  downstream forward: _UP4_CGCCCCATATAAAAAAGGAG
References
12059787,16740944,21092197,22383849,23824080,23595150

D1661093571DA4DEC5FBD8EDD3910879DAFDEE23

Page visits: 3589

Time of last update: 2022-11-28 22:26:49

Author of last update: Melvin.boenninger