aseR

aseR
168

transcriptional repressor of the [wiki|ArsR family], of [gene|C0E921ECAEE12DEC32A5DEE866762D6971360FA1|aseA] and [gene|D169C58739F17EE0D341D015592FF07CBBE1B6E1|aseR]

locus
BSU_05330
Molecular weight
12.95 kDa
pI
6.31
Protein length
Gene length
function
regulation of As (III) efflux
product
transcriptional repressor ([wiki|ArsR family])
essential
no
synonyms
aseR, ydeT

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0640

This gene is a member of the following regulons

Gene
Coordinates
579,541 → 579,876
The protein
Protein family
[wiki|ArsR family]
[wiki|Domains]
[wiki|HTH arsR-type domain] (aa 1-105) (according to UniProt)
Structure
[PDB|2OQG] (from Rhodococcus sp., 27% identity)
[AF|P96677]
Effectors of protein activity
As(III) acts as molecular inducer [Pubmed|15948947]
Expression and Regulation
Operons
genes
[gene|D169C58739F17EE0D341D015592FF07CBBE1B6E1|aseR]-[gene|C0E921ECAEE12DEC32A5DEE866762D6971360FA1|aseA]-[gene|6BA4A8575050B1BA45FF98E1F3B1F27F6C24A5E4|ydzS/1]-[gene|009BB4460A9374A8259DE7BD05724467198E0A90|ydzS/2]
description
[pubmed|22383849]
regulation
induced by As(III) ([protein|D169C58739F17EE0D341D015592FF07CBBE1B6E1|aseR]) [Pubmed|15948947]
regulatory mechanism
[protein|D169C58739F17EE0D341D015592FF07CBBE1B6E1|aseR]: repression, [Pubmed|15948947], in [regulon|protein:D169C58739F17EE0D341D015592FF07CBBE1B6E1|aseR regulon]
Open in new tab

[gene|D169C58739F17EE0D341D015592FF07CBBE1B6E1|aseR]->[gene|009BB4460A9374A8259DE7BD05724467198E0A90|ydzS/2]

2022-06-14 02:27:01

Bzhu

11

ebd49d23227107bcbdefbcbe0a6817686ade5fec

0794044A4BC2C55CDC69519799521B48FFBA83EE

Biological materials
Mutant
MGNA-C168 (ydeT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2166 NBRP B. subtilis, Japan]
BKE05330 (Δ[gene|D169C58739F17EE0D341D015592FF07CBBE1B6E1|aseR]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05330 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATGAGCTCCTCCTTCCC,  downstream forward: _UP4_TGTTGCCAGTAAGGAGGCAT
BKK05330 (Δ[gene|D169C58739F17EE0D341D015592FF07CBBE1B6E1|aseR]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05330 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATGAGCTCCTCCTTCCC,  downstream forward: _UP4_TGTTGCCAGTAAGGAGGCAT
References
15948947,16430705

D169C58739F17EE0D341D015592FF07CBBE1B6E1

Page visits: 1309

Time of last update: 2022-06-19 10:59:57

Author of last update: Melvin.boenninger