yerD

yerD
168

general stress protein, similar to glutamate synthase (ferredoxin), required for protection against paraquat stress

locus
BSU_06590
Molecular weight
58.58 kDa
pI
7.35
Protein length
Gene length
function
protection against paraquat stress
product
unknown
essential
no
synonyms
yerD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0069

This gene is a member of the following regulons

Gene
Coordinates
716,780 → 718,357
The protein
Protein family
glutamate synthase family (with [protein|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA] and [protein|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|gltB], according to UniProt)
[wiki|Cofactors]
FMN or FAD [Pubmed|21635694]
Structure
[PDB|1EA0] (from Azospirillum brasilense, corresponds to aa 184 ... 495, 30% identity)
[AF|O34849]
Paralogous protein(s)
[protein|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|D1AF9DA2594D2E2A94DC207A870C8495954A7A17|yerD]
description
[Pubmed|22383849]
regulation
induced by stress ([protein|search|SigB]) [Pubmed|15805528]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|15805528], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|D1AF9DA2594D2E2A94DC207A870C8495954A7A17|yerD]

2022-11-23 10:08:39

ghost

17

8a7c5306a68e91da05898da41672c2a7ea73f79f

21A32946C8BFCE13E4005C8696FD6CF2A4CA674A

Biological materials
Mutant
MGNA-A925 (yerD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/925 NBRP B. subtilis, Japan]
GP1184 (tet) available in [wiki|Jörg Stülke]'s lab
BKE06590 (Δ[gene|D1AF9DA2594D2E2A94DC207A870C8495954A7A17|yerD]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE06590 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTCTCAGCCTCCCTTTT,  downstream forward: _UP4_TAAAGAAACCGCCCTTGCCA
BKK06590 (Δ[gene|D1AF9DA2594D2E2A94DC207A870C8495954A7A17|yerD]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK06590 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTCTCAGCCTCCCTTTT,  downstream forward: _UP4_TAAAGAAACCGCCCTTGCCA
Expression vectors
pBP32 (expression vector for ''E. coli'' BL21; N-terminal Strep-tag-YerD fusion protein, based on [wiki|pGP172]), available in [wiki|Fabian Commichau]'s lab
FLAG-tag construct
GP1187 (spc, based on [wiki|pGP1331]), available in [wiki|Jörg Stülke]'s lab
labs
[wiki|Fabian Commichau], Göttingen, Germany [http://www.uni-goettingen.de/de/413008.html homepage]
References
15805528,22383849,23033921,22582280

D1AF9DA2594D2E2A94DC207A870C8495954A7A17

Page visits: 2218

Time of last update: 2022-12-06 02:40:50

Author of last update: Jstuelk