yokG

yokG
168

similar to delta-endotoxin

locus
BSU_21600
Molecular weight
40.58 kDa
pI
4.2
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yokG

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
2,278,602 → 2,279,675
The protein
Protein family
cry6A endotoxin family (single member, according to UniProt)
Structure
[PDB|5GHE] (Cry6Aa from B. thuringiensis, 31% identity) [pubmed|27381865]
[AF|O32000]
Biological materials
Mutant
BKE21600 (Δ[gene|D2029DC18EDCF6342986A63A37AEADDA54C5755F|yokG]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE21600 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTCTTGACCCGCCCTTT,  downstream forward: _UP4_TAAAAAATGGGTAATCTGAA
BKK21600 (Δ[gene|D2029DC18EDCF6342986A63A37AEADDA54C5755F|yokG]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK21600 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTCTTGACCCGCCCTTT,  downstream forward: _UP4_TAAAAAATGGGTAATCTGAA
References
Research papers
27381865

D2029DC18EDCF6342986A63A37AEADDA54C5755F

Page visits: 1404

Time of last update: 2022-11-26 21:39:36

Author of last update: Melvin.boenninger