yobL

yobL
168

LXG toxin, non-specific metal-dependent RNase

locus
BSU_19000
Molecular weight
67.59 kDa
pI
6.5
Protein length
Gene length
function
competetion with other bacteria in biofilms
product
LXG toxin, RNase
essential
no
ec
null
synonyms
yobL

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5444

This gene is a member of the following regulons

Gene
Coordinates
2,071,754 → 2,073,556
Phenotypes of a mutant
the mutant is outcompeted by wild type cells in biofilms [pubmed|34280190]
The protein
[wiki|Domains]
[wiki|LXG domain] (aa 1-235) (according to UniProt)
Structure
[AF|O34330]
Expression and Regulation
Operons
genes
[gene|D24F5B473B9CFAD960D877A8BA593939012177E2|yobL]-[gene|E9FE0BA3CB7ABF98762F65B619ADC6BE0EC54B4E|yobK]
description
[pubmed|22383849]
Open in new tab

Array

2022-11-23 02:54:09

Jstuelk

31

F33DB81D4A94EFC7E3A2571A1742607CF3C89F3E

F33DB81D4A94EFC7E3A2571A1742607CF3C89F3E

Biological materials
Mutant
MGNA-A309 (yobL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/309 NBRP B. subtilis, Japan]
BKE19000 (Δ[gene|D24F5B473B9CFAD960D877A8BA593939012177E2|yobL]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE19000 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATCATTCTCCTTCCTAG,  downstream forward: _UP4_TGAGGTGTTTATATGATTTA
BKK19000 (Δ[gene|D24F5B473B9CFAD960D877A8BA593939012177E2|yobL]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK19000 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATCATTCTCCTTCCTAG,  downstream forward: _UP4_TGAGGTGTTTATATGATTTA
References
22200572,34280190

D24F5B473B9CFAD960D877A8BA593939012177E2

Page visits: 1552

Time of last update: 2022-11-26 10:40:25

Author of last update: Jstuelk