ycgK

ycgK
168

similar to transcriptional regulator ([wiki|LysR family])

locus
BSU_03170
Molecular weight
36.25 kDa
pI
7.28
Protein length
Gene length
function
unknown
product
transcriptional regulator ([wiki|LysR family])
essential
no
synonyms
ycgK

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0583

This gene is a member of the following regulons

Gene
Coordinates
341,492 → 342,466
The protein
Protein family
[wiki|LysR family] (according to UniProt)
[wiki|Domains]
[wiki|HTH lysR-type domain] (aa 1-58) (according to UniProt)
Structure
[PDB|4X6G] (from Pseudomonas aeruginosa, 29% identity) [pubmed|25931525]
[AF|P94387]
Expression and Regulation
Operons
genes
[gene|D28190620D5B834DD7F42822B835C6FE932FD8A5|ycgK]-[gene|6BCE78F623A40B519211E79AFA1AD898318BD817|cah]-[gene|7306A55192AEB4032FD17A1BAAFF1127D511D70E|ycgL]
description
[Pubmed|22383849]
Open in new tab

[gene|D28190620D5B834DD7F42822B835C6FE932FD8A5|ycgK]→[gene|7306A55192AEB4032FD17A1BAAFF1127D511D70E|ycgL]

2022-11-25 20:30:44

Jstuelk

29

ab6bd4636d1fc5110090b1b0ce77491e89fa4b6d

B23BDB1B6636DD3E6BBB58391EB252FE951AC9F0

Biological materials
Mutant
MGNA-B990 (ycgK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1989 NBRP B. subtilis, Japan]
BKE03170 (Δ[gene|D28190620D5B834DD7F42822B835C6FE932FD8A5|ycgK]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE03170 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTCAGCCTCCATAGGTT,  downstream forward: _UP4_TAGAAAACAAAGACGAAACG
BKK03170 (Δ[gene|D28190620D5B834DD7F42822B835C6FE932FD8A5|ycgK]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK03170 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTCAGCCTCCATAGGTT,  downstream forward: _UP4_TAGAAAACAAAGACGAAACG
References
Research papers
25931525

D28190620D5B834DD7F42822B835C6FE932FD8A5

Page visits: 1061

Time of last update: 2022-11-26 18:23:32

Author of last update: Melvin.boenninger