SubtiWiki SubtiWiki
yfjQ

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yfjQ
168

minor magnesium transporter

locus
BSU_08000
Molecular weight
37.69 kDa
pI
5.42
Protein length
Gene length
function
magnesium uptake
product
minor magnesium transporter
essential
no
synonyms
yfjQ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0598

This gene is a member of the following regulons

Gene
Coordinates
871,347 → 872,306
Phenotypes of a mutant
a ''[gene|472E3A2407C83EEE26DB00079D185C4EA2988611|mgtE] [gene|D281B88EC444F8175AB50FB2CD24B51F4E2C96F8|yfjQ]'' mutant does not grow on rich media, this can be suppressed by the addition of 25 mM Mg2+, moreover the mutant grows well on minimal medium in the presence of citrate (due to the activity of [protein|C0DED68802EF78D2BC16507234AAC3B60D236E68|citM]) [Pubmed|24415722]
The protein
Protein family
CorA metal ion transporter (MIT) (TC 1.A.35) family (together with [protein|F0CACEFB53F4BC38DF77A38C4D78BA3DBE96E21A|corA]) (according to UniProt)
Structure
[PDB|4I0U] (from Thermotoga maritima, 37% identity) [pubmed|23425532]
Expression and Regulation
Operons
genes
[gene|D281B88EC444F8175AB50FB2CD24B51F4E2C96F8|yfjQ]
description
[pubmed|22383849]
Open in new tab

[gene|D281B88EC444F8175AB50FB2CD24B51F4E2C96F8|yfjQ]

2022-01-21 11:55:31

Jstuelk

5

e9fce27f66b01c84ca03a6a5720f57768d1c6d65

640008532AA6EEBBE18592943AF7F0B1D0DB9BB2

Biological materials
Mutant
MGNA-C274 (yfjQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2272 NBRP B. subtilis, Japan]
BKE08000 (Δ[gene|D281B88EC444F8175AB50FB2CD24B51F4E2C96F8|yfjQ]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08000 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAACAACCCTCCACCTG,  downstream forward: _UP4_TGAGGACAGCGAGCAGCTGT
BKK08000 (Δ[gene|D281B88EC444F8175AB50FB2CD24B51F4E2C96F8|yfjQ]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08000 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAACAACCCTCCACCTG,  downstream forward: _UP4_TGAGGACAGCGAGCAGCTGT
GP2853 (''[gene|D281B88EC444F8175AB50FB2CD24B51F4E2C96F8|yfjQ]''::''tet''), available in [wiki|Jörg Stülke]'s lab
References
24415722,23425532

D281B88EC444F8175AB50FB2CD24B51F4E2C96F8

Page visits: 988

Time of last update: 2022-01-18 21:01:38

Author of last update: Jstuelk