ybdG

ybdG
168

unknown

locus
BSU_01990
Molecular weight
33.34 kDa
pI
9.62
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
ybdG

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0596

This gene is a member of the following regulons

Gene
Coordinates
220,279 → 221,256
The protein
[wiki|Domains]
[wiki|AB hydrolase-1 domain] (aa 94-166) (according to UniProt)
Structure
[AF|O31431]
[wiki|Localization]
cell membrane (according to UniProt)
Biological materials
Mutant
MGNA-B955 (ybdG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1954 NBRP B. subtilis, Japan]
BKE01990 (Δ[gene|D2B8AD67EE5BA898802B4792EB2A120B99456AD1|ybdG]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE01990 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATGATGCTCCTTTCACT,  downstream forward: _UP4_GAGTTTATGAGAAAGGTTCG
BKK01990 (Δ[gene|D2B8AD67EE5BA898802B4792EB2A120B99456AD1|ybdG]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK01990 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATGATGCTCCTTTCACT,  downstream forward: _UP4_GAGTTTATGAGAAAGGTTCG

D2B8AD67EE5BA898802B4792EB2A120B99456AD1

Page visits: 891

Time of last update: 2022-12-06 02:14:09

Author of last update: Melvin.boenninger