SubtiWiki SubtiWiki

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!



Molecular weight
33.34 kDa
Protein length
Gene length

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0596

This gene is a member of the following regulons

220,279 → 221,256
The protein
[wiki|AB hydrolase-1 domain] (aa 94-166) (according to UniProt)
cell membrane (according to UniProt)
Biological materials
MGNA-B955 (ybdG::erm), available at the [ NBRP B. subtilis, Japan]
BKE01990 (Δ[gene|D2B8AD67EE5BA898802B4792EB2A120B99456AD1|ybdG]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATGATGCTCCTTTCACT,  downstream forward: _UP4_GAGTTTATGAGAAAGGTTCG
BKK01990 (Δ[gene|D2B8AD67EE5BA898802B4792EB2A120B99456AD1|ybdG]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATGATGCTCCTTTCACT,  downstream forward: _UP4_GAGTTTATGAGAAAGGTTCG


Page visits: 756

Time of last update: 2021-12-14 22:48:18

Author of last update: Melvin.boenninger