nadB

nadB
168

L-aspartate oxidase

locus
BSU_27870
Molecular weight
58.07 kDa
pI
6.45
Protein length
Gene length
function
NAD biosynthesis
product
L-aspartate oxidase
essential
no
ec
1.4.3.16
synonyms
nadB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0029

This gene is a member of the following regulons

Gene
Coordinates
2,847,871 → 2,849,466
The protein
Catalyzed reaction/ biological activity
L-aspartate + O2 --> H2O2 + iminosuccinate (according to UniProt)
Protein family
FAD-dependent oxidoreductase 2 family (with [protein|0E1FAF4B3A967CC3882B3DDB3CA2D01FD70A0F7E|sdhA], according to UniProt)
[wiki|Cofactors]
FAD (according to UniProt)
Structure
[PDB|5KXJ] (from Salmonella typhimurium, 38% identity)
[AF|P38032]
Modification
phosphorylated on Arg-104 [Pubmed|22517742]
Expression and Regulation
Operons
genes
[gene|D30D059185DFB828AB0FD07D600DBC3FD0973198|nadB]-[gene|1368734DCC28C618AA173B865784BDDAEA912623|nadC]-[gene|F92F17578F06EF2292D0923662933463D7C86498|nadA]
description
[Pubmed|8444804]
regulation
repressed in the presence of nicotinic acid ([protein|search|NadR]) [Pubmed|16199587]
regulatory mechanism
[protein|510DE075EA964D22C42DEB171509F6CDA600A402|nadR]: repression, [Pubmed|16199587], in [regulon|protein:510DE075EA964D22C42DEB171509F6CDA600A402|nadR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8444804], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
An [wiki|search|ncRNA] is predicted for '[protein|search|nadB]' [PubMed|20525796]
Open in new tab

[gene|D30D059185DFB828AB0FD07D600DBC3FD0973198|nadB]→[gene|F92F17578F06EF2292D0923662933463D7C86498|nadA]

2022-11-15 07:28:25

ghost

25

4f70dedfb39fe2edf4df8c48406b789cb6f009f0

0DADAB25BF759B1341F8AD45873BE220231A782F

Biological materials
Mutant
BKE27870 (Δ[gene|D30D059185DFB828AB0FD07D600DBC3FD0973198|nadB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE27870 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATGCCATCCTCCTGTTG,  downstream forward: _UP4_AGAAAAAACGAGGGGATTTG
BKK27870 (Δ[gene|D30D059185DFB828AB0FD07D600DBC3FD0973198|nadB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK27870 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATGCCATCCTCCTGTTG,  downstream forward: _UP4_AGAAAAAACGAGGGGATTTG
labs
[wiki|Alessandra Albertini], University of Pavia, Italy [http://www-1.unipv.it/genbiom/albertini.html homepage]
References
8444804,18959769,16199587,20525796,22517742

D30D059185DFB828AB0FD07D600DBC3FD0973198

Page visits: 2752

Time of last update: 2022-11-27 03:59:27

Author of last update: Melvin.boenninger