phrA

phrA
168

response regulator aspartate phosphatase ([protein|25D89EF3C4D57B3E6F9AB0210029651F74356906|rapA]) inhibitor, control of the [wiki|phosphorelay]

locus
BSU_12440
Molecular weight
4.66 kDa
pI
10.23
Protein length
Gene length
function
control of [wiki|sporulation] initiation
product
phosphatase ([protein|25D89EF3C4D57B3E6F9AB0210029651F74356906|rapA]) inhibitor
essential
no
synonyms
phrA, gsiAB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
1,316,995 → 1,317,129
The protein
Protein family
[wiki|phr family] (according to UniProt)
Structure
[AF|Q00829]
Expression and Regulation
Operons
genes
[gene|25D89EF3C4D57B3E6F9AB0210029651F74356906|rapA]-[gene|D31B325366D3F0169E4ECA8871645C7826019C10|phrA]
description
[Pubmed|1378051]
regulation
expressed at high cell density ([protein|search|ComA]) [Pubmed|16091051]
regulatory mechanism
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]: repression, [Pubmed|14651647], in [regulon|protein:2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A regulon]
[protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|comA]: activation, ([protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|comA]) [Pubmed|16091051], in [regulon|protein:7832489F11F606BCF637EC23BAAB41AD10237EBB|comA regulon]
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|23569278,12618455], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|12850135], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|1378051], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|25D89EF3C4D57B3E6F9AB0210029651F74356906|rapA]→[gene|D31B325366D3F0169E4ECA8871645C7826019C10|phrA]

2022-08-30 10:27:16

ghost

26

01c2a2d5cbf2bbf9b664fb434ae4609766ddb2ba

B05E6BFE73C0264C2C2D52698EA0051DCC1003E8

Biological materials
Mutant
BKE12440 (Δ[gene|D31B325366D3F0169E4ECA8871645C7826019C10|phrA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE12440 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATTTAGATTTCATATAAACA,  downstream forward: _UP4_TGATGCATAAAAAAAGACCC
BKK12440 (Δ[gene|D31B325366D3F0169E4ECA8871645C7826019C10|phrA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK12440 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATTTAGATTTCATATAAACA,  downstream forward: _UP4_TGATGCATAAAAAAAGACCC
References
8643670,8730857,11923303,1378051,14651647,12618455,12107147,19380751,16091051,20238180,27122155,32132526

D31B325366D3F0169E4ECA8871645C7826019C10

Page visits: 3972

Time of last update: 2022-10-06 10:37:16

Author of last update: Jstuelk