znuA

znuA
168

high-affinity [wiki|ABC transporter] for zinc (binding protein, lipoprotein)

locus
BSU_02850
Molecular weight
35.51 kDa
pI
5.15
Protein length
Gene length
function
zinc uptake
product
[wiki|ABC transporter] for zinc (binding protein)
essential
no
synonyms
znuA, ycdH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0803

This gene is a member of the following regulons

Gene
Coordinates
308,332 → 309,291
Phenotypes of a mutant
reduced genetic competence, can be rescued by the addition of excess zinc [Pubmed|21813502]
reduced expression of the ''[gene|45F27C0789199626BA90D2C69E8F13525C911478|comFA]-[gene|D290247A43280532947B707F3AF388D7A7F404D3|comFB]-[gene|04D9D70C0BCFDCBD00B5156908C348135080A9C2|comFC]-[gene|049B1EBF64F0EBC04CE6D529C8EDB0B6B2184DF5|yvyF]-[gene|F03144BF8A187C8931938A21433431B8961E8EE7|flgM]-[gene|6F4CD36D4C1EE99EF7A503F44F53AEB8EFFEAB7F|flgN]-[gene|767ADBEF1B40CB3C74116CEA8CFB2FAF19C1FE7B|flgK]-[gene|82AB04023BCB57967C7501E6AEAC4BB593AA6480|flgL]'' operon  [Pubmed|21813502]
The protein
Protein family
bacterial solute-binding protein 9 family (with [protein|3C40A6E42A669E77ADBF5FFF334061C51F76A4F9|mntA], according to UniProt)
Structure
[PDB|2O1E]
[AF|O34966]
Paralogous protein(s)
[protein|3C40A6E42A669E77ADBF5FFF334061C51F76A4F9|mntA]
[wiki|Localization]
inner spore membrane [Pubmed|30602489,26731423]
Expression and Regulation
Operons
genes
[gene|D33A144568CAF32FFE4A2A46BE67573DB66FC1A1|znuA]-[gene|6B5D4FD32CCE72C99B915B0F1EB4B8E8D42A04B3|znuC]-[gene|EE212953BC83BD6D69BF769D6E917F4F954BE1E2|znuB]
description
[Pubmed|9811636]
regulation
induced by zinc starvation ([protein|search|Zur]) [Pubmed|12426338]
regulatory mechanism
[protein|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|zur]: repression, in the presence of zinc [Pubmed|12426338], in [regulon|protein:A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|zur regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|12426338], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|D33A144568CAF32FFE4A2A46BE67573DB66FC1A1|znuA]→[gene|EE212953BC83BD6D69BF769D6E917F4F954BE1E2|znuB]

2022-11-30 19:19:21

ghost

39

d84622c86cda894bc37d4650ce0ef2c146681ec6

DA65C8A158A0243655AECDC10E982F7866F2A4D9

Biological materials
Mutant
BKE02850 (Δ[gene|D33A144568CAF32FFE4A2A46BE67573DB66FC1A1|znuA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE02850 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATCGTATATCCCCTCTT,  downstream forward: _UP4_TAAGATAGTGTGCGCCGGAG
BKK02850 (Δ[gene|D33A144568CAF32FFE4A2A46BE67573DB66FC1A1|znuA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK02850 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATCGTATATCCCCTCTT,  downstream forward: _UP4_TAAGATAGTGTGCGCCGGAG
References
12426338,9811636,10092453,21813502,12426338,18957862,18763711,26731423,27561249,30602489

D33A144568CAF32FFE4A2A46BE67573DB66FC1A1

Page visits: 3619

Time of last update: 2022-12-01 09:56:22

Author of last update: Melvin.boenninger