degU

degU
168

two-component response regulator, regulation of degradative enzyme expression, [wiki|genetic competence], [wiki|biofilm formation], capsule biosynthesis (together with [protein|5D479874B43F521DB52EDC2C27CDE4967F22DE47|swrA]), non-phosphorylated DegU is required for swarming motility

locus
BSU_35490
Molecular weight
25.72 kDa
pI
5.6
Protein length
Gene length
function
regulation of degradative enzymes, [wiki|genetic competence], and other adaptive responses
product
two-component response regulator
essential
no
synonyms
degU, sacU, iep

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2197

This gene is a member of the following regulons

Gene
Coordinates
3,644,607 → 3,645,296
Phenotypes of a mutant
the [gene|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU] gene is readily inactivated during domestication of B. subtilis [pubmed|33144634]
loss of [wiki|genetic competence], competence can be restored by overexpression of [gene|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK]-[gene|4D76F07D6124D56C7CEBBDAB9E84B2718BF1E7FC|comS] [pubmed|33897624]
defect in [wiki|biofilm formation] [Pubmed|20815827], this can be suppressed by [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]-independent expression of [protein|E06A3392E644FEDC6F46ED41BBE89168F59B76B3|bslA] [Pubmed|21742882]
the mutation suppresses the mucoid phenotype of [gene|86C729C7D5ABEE519ADC4A893940600BBB655EF1|motA] or [gene|FE56753D061344B0F10A6523F49C5C7356AA40B6|motB] mutants due to reduced expression of the [gene|86C05126ADBA22BB1771B1FA3D214B2E7A36311E|capB]-[gene|D66994D077D1382B88FF65075E44C2A31089548F|capC]-[gene|A696434A086A428D411CAF45B37CD8F82AC2503F|capA]-[gene|6B61DCE8D27776EBF942621D3AE90F410FD13F37|capE] operon [Pubmed|24296669]
defective in [category|SW.4.1.4|Swarming] motility [pubmed|35638827]
The protein
Catalyzed reaction/ biological activity
transcription activator and repressor (see [wiki|DegU regulon])
DegU-P represses expression of the fla/che operon (''[gene|1C6C8DB02E10EAC0588389D9F0D3AF3E19172C5C|flgB]-[gene|CC423DE6481353699B0CD3A2B8BBC36967A832CC|flgC]-[gene|7E8F88F7A9CAD4ED0927CDC6AAFDEDC08197C709|fliE]-[gene|EB815705133E3318F655F6024B7D9BA587FD1DDA|fliF]-[gene|8DDCC3D139ACCB635BF014946E1282A72D535390|fliG]-[gene|4D8CF3BED8F94DE3F8FCDEB1FE55D5F1D17FE26F|fliH]-[gene|401459F105BC8A8342341D953AE259D6C3868AB6|fliI]-[gene|600DECF2BE9ADCAB87E53790CE4F0D61F8B3F7CC|fliJ]-[gene|E7D735A16C35FBC635CFDB92ECB1C84F442D0DF0|ylxF]-[gene|42277DE1030E6FEB416EAE381CD40A54D49736FF|fliK]-[gene|819FAE47ADC9A4FE55C8F2105E19FA7EE286FC0C|flgD]-[gene|DC906ED8D787602B5796BAD8FD81F02C4BAC8D13|flgE]-[gene|2CCB8AD9238D18BA2361020A671844C021E81EE0|fliL]-[gene|1D51AF3E6456F126203D7C7273FB828A47E26DFB|fliM]-[gene|2E73F8DD89F7CFCDE7FAFC58220D8171D0913BAC|fliY]-[gene|2F0495C7EAB81BDB1F3181677C555537BD2A972F|cheY]-[gene|C2C67880EDF09E1BA75A4791628EE1982F9B6B0B|fliO]-[gene|6ED6C3DDC4F3142FD01D32840D955B7E4A19F385|fliP]-[gene|A3C07B70C87D671979D053A6272A0FCDED6F3BB7|fliQ]-[gene|9856F25F23264AD1402A85AE9E25F10B68CAD739|fliR]-[gene|68DB2871A88535714C84FE86006AB54CEB6F0EAD|flhB]-[gene|974FA844E263AA694477992FA50468CB8EFAB807|flhA]-[gene|BB6F5D7463EF96E2C6344D0BC30A227C5E3B5817|flhF]-[gene|D6D34E68FB3BAAACB533F98290FD363A5B00B2C6|flhG]-[gene|B0415A8CD040EC714B54F4038E065B3E1E20A271|cheB]-[gene|6B3B222E56BF0C95A2371CA5208B5522B44D4689|cheA]-[gene|887D84520DF3D5F22DED525C1C17130EDE60DC36|cheW]-[gene|DC9B5446484E42F46EB2B0541192D7D8B4B3AC8F|cheC]-[gene|BE9373BEB682E5F8B0938AAA4ED9B723B357ABAE|cheD]-[gene|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD]-[gene|347ACF1D4E2D0C1B4E9DF0DEA9807A6A7D1519AC|swrB]'') in the absence of [protein|0CEE58D799AF41634D161DBDF3D67EEFFF1C861E|swrAA/2], and switches to an activator of the operon in the presence of [protein|0CEE58D799AF41634D161DBDF3D67EEFFF1C861E|swrAA/2] [Pubmed|24386445]
[wiki|Domains]
[wiki|Response regulatory domain] (aa 5-121) (according to UniProt)
[wiki|HTH luxR-type domain] (aa 159-224) (according to UniProt)
Structure
[PDB|4GVP] (VraR from ''Staphylococcus aureus'', 35% identity) [Pubmed|23650349]
[AF|P13800]
Modification
phosphorylated by [protein|047CE33C0CC127DAD15D68D63843DF89F93ED3BF|degS] on Asp-56 [Pubmed|1901568], this modulates DNA-binding activity
phosphorylation by [protein|047CE33C0CC127DAD15D68D63843DF89F93ED3BF|degS] occurs in response to inhibition of flagellar rotation [Pubmed|28800172,23888912]
Effectors of protein activity
DNA-binding activity of DegU is inhibited by [protein|E1744329B6489F989F93F3E71E51E772E3926ABF|rapG] [Pubmed|12950930]
[protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]-P is degraded by [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|clpC]-[protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|clpP] [Pubmed|20070525]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|047CE33C0CC127DAD15D68D63843DF89F93ED3BF|degS]-[gene|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]
description
[Pubmed|1688843]
regulation
induced by glucose ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]) [Pubmed|23123903]
regulatory mechanism
[protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]: activation, in [regulon|protein:D343D2096664A972026D911E7A17A35C7B1CD1C9|degU regulon]
[protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA]: repression, [Pubmed|18502860], in [regulon|protein:857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA regulon]
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: activation, [Pubmed|23123903], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
[protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]: repression, [Pubmed|24317403], in [regulon|protein:5A6FBAE6553343092862CB79E150F934978C32A9|sinR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|1688843], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|047CE33C0CC127DAD15D68D63843DF89F93ED3BF|degS]→[gene|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]

2022-12-29 20:45:44

Bzhu

46

d2120c3a90e78aa86a7316960e6c6ac9791f1ad9

180E2E6A277BD691F2D486B91512361FC857D302

genes
[gene|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]
description
[Pubmed|18502860]
regulation
induced by glucose ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]) [Pubmed|23123903]
Open in new tab

[gene|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]

2022-12-29 20:45:46

Bzhu

49

257f1a2d62e3fc92fcf9c13c9a66eca2363796ce

B7D54FCF42D7EC3DDEBA1671E67F93E16CF6A20E

Biological materials
Mutant
GP2644 (Δ[gene|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]::aphA3) available in [wiki|Jörg Stülke]'s lab [pubmed|33897624]
BKE35490 (Δ[gene|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE35490 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACAAGCCACGCCTCCTTGT,  downstream forward: _UP4_TAGTATAATAGGAGACTTGC
BKK35490 (Δ[gene|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK35490 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACAAGCCACGCCTCCTTGT,  downstream forward: _UP4_TAGTATAATAGGAGACTTGC
two-hybrid system
''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jörg Stülke]'s lab
References
Reviews
20030732,19118340,23927648,24988880
Original Publications
17850253,8878039,14563871,1901568,1321152,1459944,18194340,18978066,10908654,18502860,10094672,19389763,20815827,21742882,18414485,19420703,2428811,7746142,18502860,19389763,19416356,19734658,1688843,20070525,18197985,15598897,12950930,17590234,8955341,22496484,22745669,23123903,21965392,24123822,24296669,122328658,23888912,24149708,24317403,25431404,25433860,24386445,25777015,25880922,25887289,25755103,26819068, 23650349,27026185,27920766,28800172,29124898,33144634,33897624,34487843,35638827,36416371
The [wiki|DegU regulon]
12471443

D343D2096664A972026D911E7A17A35C7B1CD1C9

Page visits: 8468

Time of last update: 2023-01-29 23:17:08

Author of last update: Jstuelk