SubtiWiki SubtiWiki
albB
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

albB
168

antilisterial bacteriocin (subtilosin) production

locus
BSU_37380
Molecular weight
5.98 kDa
pI
10.83
Protein length
Gene length
function
antilisterial bacteriocin (subtilosin) production
product
unknown
essential
no
ec
null
synonyms
albB, ywhR

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
3,837,682 → 3,837,843
The protein
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|8CBBEC47A5CC3EAE73BE68E68417C5F2A4DA5C23|sboA]-[gene|83AAFAA187B4FCEE24B4EA2DD4935425A3B48DAA|sboX]-[gene|DEDA6F03386F360F6C0B2CC5F09DF3C9D85173F1|albA]-[gene|D399B25AE22ECB6C7ACDCFF4DCE4D9D908184E75|albB]-[gene|19CC58F5ABADAD45BA55D88BBD77B586AA5D85FE|albC]-[gene|DAD8308DF72E648610D1A12BC92063E1550CB1B4|albD]-[gene|A474F01AA4AD859963E39CD528BC42FF43A72433|albE]-[gene|D03FB4EAEFBC25A5B0459CF464BFADF1FC7620B2|albF]-[gene|55A34610EF7AA5E515DE3DCDA333ED3A42B0EF08|albG]
description
[Pubmed|10572140]
regulation
expressed under anaerobic conditions ([protein|search|ResD]) [Pubmed|10809710]
regulatory mechanism
[protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|rok]: repression, [Pubmed|15743949], in [regulon|protein:1508770D5BCA5739D13E3ABD11CC5C103C07FF25|rok regulon]
[protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|resD]: activation, [Pubmed|10809710], in [regulon|protein:1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|resD regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [PubMed|10572140,17720793], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|10572140], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|8CBBEC47A5CC3EAE73BE68E68417C5F2A4DA5C23|sboA]→[gene|55A34610EF7AA5E515DE3DCDA333ED3A42B0EF08|albG]

2021-09-18 05:52:32

ghost

9

ed4c73b393efe70c9997d5f8774aa65e87aa8132

4E5A98D6615C53214EC58E0D67F433A287A88522

Biological materials
Mutant
BKE37380 (Δ[gene|D399B25AE22ECB6C7ACDCFF4DCE4D9D908184E75|albB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37380 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TGCTGGTGACAAATCGTTTC,  downstream forward: _UP4_CGCGCGCGGAAGGCTGACTC
BKK37380 (Δ[gene|D399B25AE22ECB6C7ACDCFF4DCE4D9D908184E75|albB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37380 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TGCTGGTGACAAATCGTTTC,  downstream forward: _UP4_CGCGCGCGGAAGGCTGACTC
References
10809709,10572140,15743949,10809710,10572140,17720793,19633086

D399B25AE22ECB6C7ACDCFF4DCE4D9D908184E75

Page visits: 3394

Time of last update: 2021-09-21 10:55:31

Author of last update: Melvin.boenninger