yfhC

At Gram+ 2022 in Prague, there will be a workshop on how to get the most out of SubtiWiki. We will present newly added features. Moreover, we hope to learn from you what you would like to have added to SubtiWiki to improve it!

yfhC
168

unknown

locus
BSU_08480
Molecular weight
22.31 kDa
pI
9.16
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yfhC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0778

This gene is a member of the following regulons

Gene
Coordinates
923,587 → 924,171
The protein
Protein family
[wiki|nitroreductase family] (according to UniProt)
Structure
[PDB|2I7H] (from B. cereus, 34% identity)
[AF|O31571]
Expression and Regulation
Operons
genes
[gene|27B76EFFD5F45E412BD98C67EFD9F1DEC548C00B|yfhB]-[gene|D47DD451B140132087AC7A68207C202A37A1F291|yfhC]
description
[pubmed|22383849]
Open in new tab

[gene|27B76EFFD5F45E412BD98C67EFD9F1DEC548C00B|yfhB]→[gene|D47DD451B140132087AC7A68207C202A37A1F291|yfhC]

2022-01-26 15:56:11

Jstuelk

7

b27c8c32db3bd5dbad34b9e3deb6e92fec5c6487

4704F7979D249271F98F72FB327131AC89FF08CF

genes
[gene|D47DD451B140132087AC7A68207C202A37A1F291|yfhC]
description
[pubmed|22383849]
regulatory mechanism
[protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur]: repression, [pubmed|12354229], in [regulon|protein:F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur regulon]
Open in new tab

[gene|D47DD451B140132087AC7A68207C202A37A1F291|yfhC]

2022-02-21 07:20:24

Bzhu

8

eb6dabd399c1e78d7904fc92cb7239d0223c6a63

F2C944BC3012A0F881BE24304EEA24A9F2D8119F

Biological materials
Mutant
MGNA-C358 (yfhC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2356 NBRP B. subtilis, Japan]
BKE08480 (Δ[gene|D47DD451B140132087AC7A68207C202A37A1F291|yfhC]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08480 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACCGTCTCACCTTCCTA,  downstream forward: _UP4_TAAAAAACCCCTTGTCTCAA
BKK08480 (Δ[gene|D47DD451B140132087AC7A68207C202A37A1F291|yfhC]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08480 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACCGTCTCACCTTCCTA,  downstream forward: _UP4_TAAAAAACCCCTTGTCTCAA
References
12354229

D47DD451B140132087AC7A68207C202A37A1F291

Page visits: 1145

Time of last update: 2022-05-21 07:25:00

Author of last update: Melvin.boenninger