ydbO

ydbO
168

similar to cation efflux system

locus
BSU_04540
Molecular weight
31.33 kDa
pI
6.23
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ydbO

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0053

This gene is a member of the following regulons

Gene
Coordinates
506,866 → 507,738
The protein
Protein family
[wiki|Cation diffusion facilitator (CDF) transporter (TC 2.A.4) family] (according to UniProt)
Structure
[PDB|5VRF] (from Shewanella oneidensis, 26% identity) [pubmed|29507252]
[AF|P96610]
Paralogous protein(s)
[protein|72BF9B934CB5800E156263FF377DED0AD2E920A9|mneS], [protein|28C7CFE5701F6920652BE1973DC7A15D7C088E35|mneP]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|D52111E81E9233DABAEFCAF6217145CF6A7F3961|ydbO]
description
[Pubmed|22383849]
Open in new tab

[gene|D52111E81E9233DABAEFCAF6217145CF6A7F3961|ydbO]

2022-11-26 11:04:56

Jstuelk

28

baa7ade75ca9d8244024b683bd9b75daf96dcb5f

010856E82635406D9E7BFF7D772B5C9748CD9F61

Biological materials
Mutant
MGNA-C120 (ydbO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2118 NBRP B. subtilis, Japan]
BKE04540 (Δ[gene|D52111E81E9233DABAEFCAF6217145CF6A7F3961|ydbO]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE04540 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGAATACCAGCCTCCAT,  downstream forward: _UP4_ATAAAATAAGGCTGTTTAAC
BKK04540 (Δ[gene|D52111E81E9233DABAEFCAF6217145CF6A7F3961|ydbO]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK04540 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGAATACCAGCCTCCAT,  downstream forward: _UP4_ATAAAATAAGGCTGTTTAAC
References
Research papers
29507252

D52111E81E9233DABAEFCAF6217145CF6A7F3961

Page visits: 1488

Time of last update: 2022-11-28 13:22:51

Author of last update: Melvin.boenninger