ipi

ipi
168

intracellular proteinase inhibitor

locus
BSU_11130
Molecular weight
13.93 kDa
pI
4.69
Protein length
Gene length
function
control of intracellular proteolysis
product
intracellular proteinase inhibitor
essential
no
synonyms
ipi

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
1,189,646 → 1,190,005
The protein
Structure
[PDB|3ISY]
[AF|P39804]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|D5536B27AFF8ADE7FAEA9B815F2607FC33B66404|ipi]
description
[Pubmed|8226659]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|26577401], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|D5536B27AFF8ADE7FAEA9B815F2607FC33B66404|ipi]

2022-12-29 11:11:42

ghost

20

693374bb3908275ccf6277a335686db605952045

2B246665D34A85C5BA8A5761544B6BA956A6DAC6

genes
[gene|07ABC6A548F1186B67B58C0E14915AC3FE94882E|yitT]-[gene|D5536B27AFF8ADE7FAEA9B815F2607FC33B66404|ipi]
description
[Pubmed|27965289]
regulation
induced by stress ([protein|search|SigB]) [Pubmed|15805528]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|15805528], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|07ABC6A548F1186B67B58C0E14915AC3FE94882E|yitT]→[gene|D5536B27AFF8ADE7FAEA9B815F2607FC33B66404|ipi]

2022-12-29 11:11:44

ghost

23

655e072d2aa7e8bdb499d30395343a3de006c472

45FF16F6CCFAD62B7216DF30D0E20E4D7660381B

Biological materials
Mutant
BKE11130 (Δ[gene|D5536B27AFF8ADE7FAEA9B815F2607FC33B66404|ipi]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE11130 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCCGCCTGATACCTCCT,  downstream forward: _UP4_TAAGAGGCTATGGCGAGTCG
BKK11130 (Δ[gene|D5536B27AFF8ADE7FAEA9B815F2607FC33B66404|ipi]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK11130 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCCGCCTGATACCTCCT,  downstream forward: _UP4_TAAGAGGCTATGGCGAGTCG
References
8226659,22585087,24555072,26577401,27965289

D5536B27AFF8ADE7FAEA9B815F2607FC33B66404

Page visits: 1648

Time of last update: 2023-02-02 08:48:22

Author of last update: Bzhu