yngF

yngF
168

methylglutaconyl-CoA hydratase

locus
BSU_18220
Molecular weight
27.72 kDa
pI
7.67
Protein length
Gene length
function
mother cell metabolism, leucine utilization
product
methylglutaconyl-CoA hydratase
essential
no
ec
4.2.1.18
synonyms
yngF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1024

This gene is a member of the following regulons

Gene
Coordinates
1,951,228 → 1,952,010
The protein
Catalyzed reaction/ biological activity
3-methylglutaconyl-CoA --→(S)-3-hydroxy-3-methylglutaryl-CoA [Pubmed|19935659]
Protein family
[wiki|enoyl-CoA hydratase/isomerase family] (according to UniProt)
Structure
[PDB|3KQF] (from ''B. anthracis'')
[AF|O34893]
Paralogous protein(s)
[protein|25B45D6A90AD5152FDA71718B14767EA86ECA15B|yhaR], (34%)
Expression and Regulation
Operons
genes
[gene|BA28DFBAF88A4994B0541D1FF2187312FDE1FA15|yngJ]-[gene|5F73ACDEAFC7F1EB26D55195100C3283FC1F587C|yngI]-[gene|CAF58B4BAEB03353CF80A2862590888D07B48E2C|yngH]-[gene|1FBF1512C28BCE04E7D51247D94DC88C72FBFF07|yngHB]-[gene|EEEE69A98DFAA3327FBC04F1422E959D8B44AF20|yngG]-[gene|D5CCFDE9312909B7E5B98876794569357791C76B|yngF]-[gene|2192474E13EAF6D2CF97CB957864FC89ED0118E0|yngE]
description
[Pubmed|12662922]
regulation
expressed during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|15699190,12662922]
sigma factors
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]: sigma factor, [Pubmed|15699190,12662922], in [regulon|protein:3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE regulon]
Open in new tab

[gene|BA28DFBAF88A4994B0541D1FF2187312FDE1FA15|yngJ]→[gene|2192474E13EAF6D2CF97CB957864FC89ED0118E0|yngE]

2022-12-10 08:25:09

ghost

35

ec5ff58c486f073be542df6cbb7bc2ebb4e5deee

AC16F1F9497F11969688D82F5CC45D78083A44DD

Biological materials
Mutant
BKE18220 (Δ[gene|D5CCFDE9312909B7E5B98876794569357791C76B|yngF]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE18220 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGTATGCGTCCTCCCTT,  downstream forward: _UP4_TACAAGGGAATATAAAAGGG
BKK18220 (Δ[gene|D5CCFDE9312909B7E5B98876794569357791C76B|yngF]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK18220 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGTATGCGTCCTCCCTT,  downstream forward: _UP4_TACAAGGGAATATAAAAGGG
References
15699190,12662922,19935659

D5CCFDE9312909B7E5B98876794569357791C76B

Page visits: 1406

Time of last update: 2023-02-04 00:22:58

Author of last update: Melvin.boenninger