gerKC

gerKC
168

nutrient receptor

locus
BSU_03710
Molecular weight
45.67 kDa
pI
9.04
Protein length
Gene length
function
germination
product
nutrient receptor
essential
no
synonyms
gerKC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5903

This gene is a member of the following regulons

Gene
Coordinates
421,734 → 422,957
The protein
Protein family
[wiki|GerABKC lipoprotein family] (according to UniProt)
Structure
[AF|P49941]
[wiki|Localization]
spore inner membrane [Pubmed|21696470]
Expression and Regulation
Operons
genes
[gene|EDB2F4C132211F01654F2A2ED3D220EC15CE6F22|gerKA]-[gene|D5D4E1E182F972BEF6BB432A7FF25EF45F1F0D95|gerKC]-[gene|D1AFCB1BE693AB6B8461B7764B6641E6EB1404FA|gerKB]
description
[pubmed|22383849]
regulation
expressed during sporulation ([protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG], [wiki|SpoVT]) [Pubmed|16707705]
regulatory mechanism
[protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT]: repression, [Pubmed|16707705], in [regulon|protein:01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT regulon]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|16707705], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
additional information
700 molecules are present per spore [PubMed|23749970]
Open in new tab

[gene|EDB2F4C132211F01654F2A2ED3D220EC15CE6F22|gerKA]→[gene|D1AFCB1BE693AB6B8461B7764B6641E6EB1404FA|gerKB]

2022-12-29 08:22:13

Jstuelk

23

2621476d83b6d6d9772912d035f86d1791de6cd2

5744A84AC240BED93491E29AB72B18EEE120A73F

Biological materials
Mutant
BKE03710 (Δ[gene|D5D4E1E182F972BEF6BB432A7FF25EF45F1F0D95|gerKC]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE03710 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AAGCATGAGAACGGCTAATA,  downstream forward: _UP4_TAGGTCTGAAGAAAGGGGAA
BKK03710 (Δ[gene|D5D4E1E182F972BEF6BB432A7FF25EF45F1F0D95|gerKC]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK03710 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AAGCATGAGAACGGCTAATA,  downstream forward: _UP4_TAGGTCTGAAGAAAGGGGAA
References
16707705,21696470,16352818,23396907,24752279,22343299,16740944,26731423

D5D4E1E182F972BEF6BB432A7FF25EF45F1F0D95

Page visits: 1759

Time of last update: 2023-02-07 14:42:27

Author of last update: Melvin.boenninger