bpr

bpr
168

bacillopeptidase F

locus
BSU_15300
Molecular weight
154.34 kDa
pI
4.98
Protein length
Gene length
function
protein degradation
product
bacillopeptidase F
essential
no
synonyms
bpr, bpf

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG4412

This gene is a member of the following regulons

Gene
Coordinates
1,599,283 → 1,603,584
The protein
Protein family
[wiki|peptidase S8 family] (according to UniProt)
[wiki|Domains]
Inhibitor I9 domain (aa 68-177) (according to UniProt)
Peptidase S8 domain (aa 200-512) (according to UniProt)
Structure
[PDB|6PAK] ([protein|0B98DE9CE2D98FFDE9F6EEB4E94FA1E5204BD48D|aprE], corresponds to aa 199 ... 507, 32% identity) [pubmed|31615894]
[AF|P16397]
[wiki|Localization]
secreted (according to Swiss-Prot),  extracellular (signal peptide) [Pubmed|18957862]
Expression and Regulation
Operons
genes
[gene|D5EBF5881EB3F89C9098DDE6EF18C8EBB02A278C|bpr]
description
[pubmed|22383849]
regulation
repressed by glucose (7.7-fold) [Pubmed|12850135]
regulatory mechanism
[protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]-P [Pubmed|18194340], in [regulon|protein:D343D2096664A972026D911E7A17A35C7B1CD1C9|degU regulon]
Open in new tab

[gene|D5EBF5881EB3F89C9098DDE6EF18C8EBB02A278C|bpr]

2022-11-11 07:16:52

Bzhu

13

7173ec171325e3d409066fc8af606e8312c6d43b

0EF7FBDA6FC11BE4610EA5DE17247E508D5D58F8

Biological materials
Mutant
KO7 (''ΔnprE  ΔaprE  Δepr  Δmpr  ΔnprB  Δvpr  Δbpr''), available as BGSC 1A1133
BKE15300 (Δ[gene|D5EBF5881EB3F89C9098DDE6EF18C8EBB02A278C|bpr]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE15300 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTCATCCCCCTTTTTC,  downstream forward: _UP4_TAAGTGGAAAAAAAGCTGCC
BKK15300 (Δ[gene|D5EBF5881EB3F89C9098DDE6EF18C8EBB02A278C|bpr]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK15300 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTCATCCCCCTTTTTC,  downstream forward: _UP4_TAAGTGGAAAAAAAGCTGCC
References
Reviews
34410368
Original Publications
2106512,18414485,18194340,24149708,18957862,12850135,24115457,31615894

D5EBF5881EB3F89C9098DDE6EF18C8EBB02A278C

Page visits: 2990

Time of last update: 2022-11-27 08:09:58

Author of last update: Jstuelk