tmrB

tmrB
168

tunicamycin resistance protein, ATP-binding membrane protein

locus
BSU_03140
Molecular weight
22.58 kDa
pI
9.71
Protein length
Gene length
function
resistance to tunicamycin
product
tunicamycin resistance protein
essential
no
synonyms
tmrB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
339,156 → 339,749
The protein
Structure
[PDB|2VLI] (from Deinococcus radiodurans, 39% identity) [pubmed|18540055]
[AF|P12921]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|D68A0EE33D25FDD7D130CFA21312EBD635B0B4D7|tmrB]
description
(according to [http://dbtbs.hgc.jp/COG/prom/tmrB.html DBTBS]) null
Open in new tab

[gene|D68A0EE33D25FDD7D130CFA21312EBD635B0B4D7|tmrB]

2022-11-25 10:17:28

ghost

11

6bfa8d502db096a51201b21530ca2b6ac07edf51

945A304F2A448D4432FC2A0C11FFB7AE467C2D6E

Biological materials
Mutant
BKE03140 (Δ[gene|D68A0EE33D25FDD7D130CFA21312EBD635B0B4D7|tmrB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE03140 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCGCCATTTCTCCCTTCC,  downstream forward: _UP4_TAAAGCTTCTGTACACGACA
BKK03140 (Δ[gene|D68A0EE33D25FDD7D130CFA21312EBD635B0B4D7|tmrB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK03140 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCGCCATTTCTCCCTTCC,  downstream forward: _UP4_TAAAGCTTCTGTACACGACA
References
1624425,18540055

D68A0EE33D25FDD7D130CFA21312EBD635B0B4D7

Page visits: 1246

Time of last update: 2022-12-01 16:47:02

Author of last update: Melvin.boenninger