gerBB

gerBB
168

nutrient receptor, germination response to the combination of glucose, fructose, and KCl

locus
BSU_35810
Molecular weight
41.55 kDa
pI
9.89
Protein length
Gene length
function
germination
product
nutrient receptor
essential
no
synonyms
gerBB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5902

This gene is a member of the following regulons

Gene
Coordinates
3,690,269 → 3,691,375
The protein
Protein family
[wiki|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt)
[wiki|Spore germination protein (SGP) (TC 2.A.3.9) family] (according to UniProt)
Structure
[AF|P39570]
Paralogous protein(s)
[protein|5FF739B8C087207039BB6DC293EE77F59337ED0B|gerAB], [protein|B14179D0EF5D3493E5CDB8E15378A5088B4FFD10|yndE], [protein|D1AFCB1BE693AB6B8461B7764B6641E6EB1404FA|gerKB]
[wiki|Localization]
spore inner membrane [Pubmed|21696470]
Expression and Regulation
Operons
genes
[gene|3368743E6E03792DB83A38A19989123304DF7560|gerBA]-[gene|D70EC7C02BC79BED724489ABCB6356447F215B87|gerBB]-[gene|93D4D6864686E6E559E6CEFA69BAC77EEFAA1BE3|gerBC]
description
[Pubmed|8012571]
regulation
expressed late during sporulation in the forespore ([protein|search|SigG]) [Pubmed|15699190,8012571]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|15699190,8012571], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
additional information
700 molecules are present per spore [PubMed|23749970]
Open in new tab

[gene|3368743E6E03792DB83A38A19989123304DF7560|gerBA]→[gene|93D4D6864686E6E559E6CEFA69BAC77EEFAA1BE3|gerBC]

2022-12-29 20:54:15

ghost

24

11403d1061e669b27b23e28630f92c3f61532965

BDB4DB82BD783DEB3DA0C1C26208AF22202AD946

Biological materials
Mutant
BKE35810 (Δ[gene|D70EC7C02BC79BED724489ABCB6356447F215B87|gerBB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE35810 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATGCTCTGATTTCCTCATAG,  downstream forward: _UP4_AAAATAGGGAGGGGGCAGCT
BKK35810 (Δ[gene|D70EC7C02BC79BED724489ABCB6356447F215B87|gerBB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK35810 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATGCTCTGATTTCCTCATAG,  downstream forward: _UP4_AAAATAGGGAGGGGGCAGCT
References
10348844,12670969,15774895,7812448,8012571,16352818,21696470,23396907

D70EC7C02BC79BED724489ABCB6356447F215B87

Page visits: 1850

Time of last update: 2023-02-05 02:44:20

Author of last update: Melvin.boenninger