azlB

azlB
168

transcriptional repressor ([wiki|Lrp family]) of the [gene|D7397591C2157EBB1951ED3DC1E315F9AE7A4BB3|azlB]-[gene|C90D642197EE589F9D33CD5AA0B1069E3BC124A8|azlC]-[gene|7A1445B7AFD9C3AA45EF67E51F5D233FCC5F8884|azlD]-[gene|8BB8BDA602CC26B0A9E8C22666F0EC539306CF39|brnQ]-[gene|17FFEA4977F4F7334CFF7CD1C644DF14F599E6E6|yrdK] operon

locus
BSU_26720
Molecular weight
17.32 kDa
pI
4.87
Protein length
Gene length
function
regulation of branched-chain amino acid transport and histidine export
product
transcriptional repressor ([wiki|Lrp family])
essential
no
synonyms
azlB, yrdG

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1522

This gene is a member of the following regulons

Gene
Coordinates
2,729,753 → 2,730,226
The protein
Catalyzed reaction/ biological activity
binds to the promoter region of the [gene|D7397591C2157EBB1951ED3DC1E315F9AE7A4BB3|azlB]-[gene|C90D642197EE589F9D33CD5AA0B1069E3BC124A8|azlC]-[gene|7A1445B7AFD9C3AA45EF67E51F5D233FCC5F8884|azlD]-[gene|8BB8BDA602CC26B0A9E8C22666F0EC539306CF39|brnQ]-[gene|17FFEA4977F4F7334CFF7CD1C644DF14F599E6E6|yrdK] operon to repress its expression [pubmed|36377869]
Protein family
[wiki|Lrp family]
[wiki|Domains]
[wiki|HTH asnC-type domain] (aa 5-66) (according to UniProt)
Structure
[PDB|2GQQ] (E. coli Lrp, 34% identity) [pubmed|17223133]
[AF|O07920]
Effectors of protein activity
no inducer that triggers release of [protein|D7397591C2157EBB1951ED3DC1E315F9AE7A4BB3|azlB] from the promoter DNA is known [pubmed|36377869]
Expression and Regulation
Operons
genes
[gene|D7397591C2157EBB1951ED3DC1E315F9AE7A4BB3|azlB]-[gene|C90D642197EE589F9D33CD5AA0B1069E3BC124A8|azlC]-[gene|7A1445B7AFD9C3AA45EF67E51F5D233FCC5F8884|azlD]-[gene|8BB8BDA602CC26B0A9E8C22666F0EC539306CF39|brnQ]-[gene|17FFEA4977F4F7334CFF7CD1C644DF14F599E6E6|yrdK]
description
[Pubmed|36377869,9287000]
regulation
repressed by [protein|D7397591C2157EBB1951ED3DC1E315F9AE7A4BB3|azlB] [Pubmed|36377869,9287000]
regulatory mechanism
[protein|D7397591C2157EBB1951ED3DC1E315F9AE7A4BB3|azlB]: repression, [Pubmed|36377869,9287000], in [regulon|protein:D7397591C2157EBB1951ED3DC1E315F9AE7A4BB3|azlB regulon]
Open in new tab

[gene|D7397591C2157EBB1951ED3DC1E315F9AE7A4BB3|azlB]→[gene|17FFEA4977F4F7334CFF7CD1C644DF14F599E6E6|yrdK]

2022-12-01 22:01:55

Jstuelk

29

CE7A54721725B20F53C4F64C9153F7B05416307A

77D75B92D3B22CF1350DD9E108E868095EE55DEB

Biological materials
Mutant
GP3600([gene|D7397591C2157EBB1951ED3DC1E315F9AE7A4BB3|azlB]::spc trpC2), available in [wiki|Jörg Stülke]'s lab [pubmed|36377869]
GP3601 (Δ[gene|D7397591C2157EBB1951ED3DC1E315F9AE7A4BB3|azlB]-[gene|C90D642197EE589F9D33CD5AA0B1069E3BC124A8|azlC]-[gene|7A1445B7AFD9C3AA45EF67E51F5D233FCC5F8884|azlD]::''kan'') , available in [wiki|Jörg Stülke]'s lab [pubmed|36377869]
GP3623 (Δ[gene|D7397591C2157EBB1951ED3DC1E315F9AE7A4BB3|azlB]-[gene|C90D642197EE589F9D33CD5AA0B1069E3BC124A8|azlC]-[gene|7A1445B7AFD9C3AA45EF67E51F5D233FCC5F8884|azlD]::''spec'') , available in [wiki|Jörg Stülke]'s lab [pubmed|36377869]
BKE26720 (Δ[gene|D7397591C2157EBB1951ED3DC1E315F9AE7A4BB3|azlB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE26720 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTCACAACCCCCAATAC,  downstream forward: _UP4_GATGAAATGTAGGAGGTTGT
BKK26720 (Δ[gene|D7397591C2157EBB1951ED3DC1E315F9AE7A4BB3|azlB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK26720 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTCACAACCCCCAATAC,  downstream forward: _UP4_GATGAAATGTAGGAGGTTGT
lacZ fusion
pGP3808 (in [wiki|pAC7]), available in [wiki|Jörg Stülke]'s lab [pubmed|36377869]
References
9287000,17223133,36377869

D7397591C2157EBB1951ED3DC1E315F9AE7A4BB3

Page visits: 1543

Time of last update: 2022-12-01 01:00:13

Author of last update: Jstuelk