ybxA
Register now for Subtillery 2022, the International Online Meeting on Bacillus subtilis! It will be held from the 19th-22th of September.

ybxA
168

ATP-binding A1 component of [wiki|ECF transporter]s

locus
BSU_01450
Molecular weight
31.31 kDa
pI
4.77
Protein length
Gene length
function
uptake of micronutrients
product
[wiki|ECF transporter] (ATP-binding protein)
essential
no
ec
3.6.3.-
synonyms
ybxA, ybaD, ecfA1

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1122

This gene is a member of the following regulons

Gene
Coordinates
150,443 → 151,288
The protein
Protein family
[wiki|ABC transporter superfamily] (according to UniProt)
[wiki|Domains]
[wiki|ABC transporter domain] (aa 7-242) (according to UniProt)
Structure
[PDB|4HUQ] (EcfA1-EcfA2-EcfT-FolT complex of ''Lactobacillus brevis''), [Pubmed|23584589]
[AF|P40735]
Paralogous protein(s)
[protein|5ABF4F7A3D00B523F67B281241A6A8101EC60057|ybaE]
[wiki|Localization]
membrane associated (via [protein|7DC7BD54ED425859FFD45B8B6F3522750A938835|ybaF]) [Pubmed|10092453]
Biological materials
Mutant
BKE01450 (Δ[gene|D8637043C7E2291589C966E95F94DC61B1A8AB75|ybxA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01450 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGGAAAACCGGCCTCCTC,  downstream forward: _UP4_AAGATGTAGAGCATCGCTAT
BKK01450 (Δ[gene|D8637043C7E2291589C966E95F94DC61B1A8AB75|ybxA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01450 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGGAAAACCGGCCTCCTC,  downstream forward: _UP4_AAGATGTAGAGCATCGCTAT
BP1149 ([gene|D8637043C7E2291589C966E95F94DC61B1A8AB75|ybxA]-[gene|5ABF4F7A3D00B523F67B281241A6A8101EC60057|ybaE]-[gene|7DC7BD54ED425859FFD45B8B6F3522750A938835|ybaF]::cat trp+) available at [wiki|Jörg Stülke]'s and [wiki|Fabian Commichau]'s labs
References
10092453,20497229,22574898,24362466

D8637043C7E2291589C966E95F94DC61B1A8AB75

Page visits: 2190

Time of last update: 2022-08-07 07:57:45

Author of last update: Melvin.boenninger