ycsE

ycsE
168

5'-nucleotidase, dephosphorylation of the riboflavin precursor, 5-amino-6-ribitylamino-2,4(1H,3H)-pyrimidinedione 5'-phosphate

locus
BSU_04040
Molecular weight
27.92 kDa
pI
4.49
Protein length
Gene length
function
dephosphorylation of the riboflavin precursor, 5-amino-6-ribitylamino-2,4(1H,3H)-pyrimidinedione 5'-phosphate
product
5'-nucleotidase
essential
no
synonyms
ycsE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0561

This gene is a member of the following regulons

Gene
Coordinates
456,068 → 456,817
The protein
Catalyzed reaction/ biological activity
dephosphorylation of the riboflavin precursor, 5-amino-6-ribitylamino-2,4(1H,3H)-pyrimidinedione 5'-phosphate [Pubmed|26316208]
5-amino-6-(5-phospho-D-ribitylamino)uracil + H2O --> 5-amino-6-(D-ribitylamino)uracil + phosphate (according to UniProt)
Protein family
[wiki|HAD superfamily] (according to UniProt) [Pubmed|26316208]
[wiki|Cof family] (according to UniProt)
Structure
[PDB|1NRW] ([protein|AF9523D3AA3C032B70175BCFFED34E9A42ED01AF|phoC], 31% identity)
[AF|P42962]
Expression and Regulation
Operons
genes
[gene|D8AC0ECC57C6113D0CCA36FC38395EECBD00FF50|ycsE]
description
[Pubmed|22383849]
Open in new tab

[gene|D8AC0ECC57C6113D0CCA36FC38395EECBD00FF50|ycsE]

2022-12-01 02:37:37

ghost

14

110c8c6adcbe1ecd6edf0513a5466b3a58836658

F9ECB702137765A1415D8621AAC00A10E36716BD

Biological materials
Mutant
MGNA-C071 (ycsE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2069 NBRP B. subtilis, Japan]
BKE04040 (Δ[gene|D8AC0ECC57C6113D0CCA36FC38395EECBD00FF50|ycsE]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE04040 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATATGTACCTCTCTTTA,  downstream forward: _UP4_TAAAAAAAGAGAGTCCTAAG
BKK04040 (Δ[gene|D8AC0ECC57C6113D0CCA36FC38395EECBD00FF50|ycsE]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK04040 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATATGTACCTCTCTTTA,  downstream forward: _UP4_TAAAAAAAGAGAGTCCTAAG
References
16990279,27784292,26316208,22383849,25848029

D8AC0ECC57C6113D0CCA36FC38395EECBD00FF50

Page visits: 1447

Time of last update: 2022-12-01 09:14:19

Author of last update: Melvin.boenninger