gmuD

gmuD
168

phospho-beta-mannosidase

locus
BSU_05840
Molecular weight
54.17 kDa
pI
5.73
Protein length
Gene length
function
glucomannan utilization
product
phospho-beta-mannosidase
essential
no
synonyms
gmuD, ydhP

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2723

This gene is a member of the following regulons

Gene
Coordinates
628,630 → 630,027
The protein
Catalyzed reaction/ biological activity
6-phospho-β-D-glucosyl-(1→4)-D-glucose + H2O --> D-glucose + D-glucose 6-phosphate (according to UniProt)
Protein family
[wiki|glycosyl hydrolase 1 family] (according to UniProt)
Structure
[PDB|4B3K] (from Streptococcus pyogenes, 50% identity) [pubmed|23275159]
[AF|O05508]
Expression and Regulation
Operons
genes
[gene|00A4A90685CED4AD46829C45718CF26F1D62F5D3|gmuB]-[gene|44014896157718D3A6190DFDBD663C5CB9DA63FC|gmuA]-[gene|76324E0A6CAA8E1DD0B0C6FAE1CAB402231BF7CC|gmuC]-[gene|D8C81A8768E9C6B47B5E196B54DC2A3A8256E7E6|gmuD]-[gene|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|gmuR]-[gene|EB6DE119E6FB18413DB2C2B62B114FB787164F74|gmuE]-[gene|35225776F6044513D3E77DBBD6A7A8FE976F506A|gmuF]-[gene|289ACC9D13BBFAA5C083EE525ECCC32DB06E075F|gmuG]
description
[Pubmed|18177310]
regulation
induced by cellobiose ([protein|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|gmuR]) [Pubmed|18177310]
regulatory mechanism
[protein|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|gmuR]: repression, [Pubmed|18177310], in [regulon|protein:64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|gmuR regulon]
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|18177310], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: activation, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|18177310], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|00A4A90685CED4AD46829C45718CF26F1D62F5D3|gmuB]→[gene|289ACC9D13BBFAA5C083EE525ECCC32DB06E075F|gmuG]

2022-09-27 09:54:28

Jstuelk

16

1716709ba10a9af523abc0d89eb44ea784dd12d9

42FBC6CD7712CC913DB98C4B417CB4A13C8FAE20

Biological materials
Mutant
MGNA-C191 (ydhP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2189 NBRP B. subtilis, Japan]
BKE05840 (Δ[gene|D8C81A8768E9C6B47B5E196B54DC2A3A8256E7E6|gmuD]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE05840 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TGCCAAGTCTCTCTCCCCTT,  downstream forward: _UP4_TAGATTTTCCTAAAGGTCAA
BKK05840 (Δ[gene|D8C81A8768E9C6B47B5E196B54DC2A3A8256E7E6|gmuD]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK05840 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TGCCAAGTCTCTCTCCCCTT,  downstream forward: _UP4_TAGATTTTCCTAAAGGTCAA
References
14652714,18177310,15139916,10627040,20817675,23275159

D8C81A8768E9C6B47B5E196B54DC2A3A8256E7E6

Page visits: 1991

Time of last update: 2022-09-27 22:04:24

Author of last update: Melvin.boenninger