rocB

rocB
168

involved in arginine and ornithine utilization

locus
BSU_37770
Molecular weight
64.74 kDa
pI
5.35
Protein length
Gene length
function
arginine, ornithine and citrulline utilization
product
unknown
essential
no
synonyms
rocB, ipa-77d

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG4187

This gene is a member of the following regulons

Gene
Coordinates
3,877,192 → 3,878,892
The protein
Structure
[AF|P39635]
Paralogous protein(s)
[protein|D8607250EEE380DA8E1CC291B21D5626FA33313E|yqjN]
Expression and Regulation
Operons
genes
[gene|69838717DC6BB27864D88C282BF5BC7CC558BFD7|rocA]-[gene|D8D79BC7E98754963CA9DC577B90929A5A9CE051|rocB]-[gene|9BFB16C12B31ABD70BBB921BCB9E4201E3BDC92D|rocC]
description
[Pubmed|8113162]
regulation
expression during spore [wiki|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
regulatory mechanism
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|12618455], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|BEE6F16D6A5BBC7FED9E8EB5FA6A94BBF932BBDA|rocR]: activation, [Pubmed|8113162], in [regulon|protein:BEE6F16D6A5BBC7FED9E8EB5FA6A94BBF932BBDA|rocR regulon]
[protein|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC]: activation, [Pubmed|7565595], in [regulon|protein:62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|sigL]: sigma factor, [Pubmed|8113162], in [regulon|protein:1118A21CC581B0470EC6E7C178F2523CDCA70F93|sigL regulon]
additional information
expression of the ''[protein|search|rocA]-[protein|search|rocB]-[protein|search|rocC]'' operon is increased upon depletion of ''[wiki|nusA]'' (resulting from increased ''[wiki|ahrC]'' expression) [http://www.nature.com/articles/nmicrobiol20157 Reference]
Open in new tab

[gene|69838717DC6BB27864D88C282BF5BC7CC558BFD7|rocA]→[gene|9BFB16C12B31ABD70BBB921BCB9E4201E3BDC92D|rocC]

2022-12-03 14:40:30

ghost

32

2dc790ed3d8c4b63bb982c1f1d977b49cce4042b

BCA34B2E2917A99583D79922F2E2CBC45D25A78E

Biological materials
Mutant
BKE37770 (Δ[gene|D8D79BC7E98754963CA9DC577B90929A5A9CE051|rocB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE37770 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAATTGTCCTCCTGATC,  downstream forward: _UP4_AAAGAACCAAAGGGGGAAGG
BKK37770 (Δ[gene|D8D79BC7E98754963CA9DC577B90929A5A9CE051|rocB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK37770 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAATTGTCCTCCTGATC,  downstream forward: _UP4_AAAGAACCAAAGGGGGAAGG
GP3713 ([gene|D8D79BC7E98754963CA9DC577B90929A5A9CE051|rocB]::aphA3 trpC2) available in the [wiki|Stülke] lab
GP3720 ([gene|D8D79BC7E98754963CA9DC577B90929A5A9CE051|rocB]::cat trpC2) available in the [wiki|Stülke] lab
GP3722 ([gene|D8D79BC7E98754963CA9DC577B90929A5A9CE051|rocB]::tet trpC2) available in the [wiki|Stülke] lab
Expression vectors
pGP3731: expression of His6-''rocB'' (''gapA'' RBS) by [wiki|pBQ200] in ''B. subtilis'', available in [wiki|Jörg Stülke]'s lab
pGP3793: IPTG inducible expression, purification in ''E. coli'' with N-terminal Strep-tag, in [wiki|pGP172], available in [wiki|Jörg Stülke]'s lab
pGP3781: expression of Strep-''rocB'' by [wiki|pGP380] in ''B. subtilis'' suitable for [wiki|SPINE], available in [wiki|Jörg Stülke]'s lab
References
7565595,12618455,8113162,27766092

D8D79BC7E98754963CA9DC577B90929A5A9CE051

Page visits: 2218

Time of last update: 2022-12-04 03:56:05

Author of last update: Robert.warneke