SubtiWiki SubtiWiki
ycgE

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

ycgE
168

similar to transcription regulator

locus
BSU_03080
Molecular weight
17.10 kDa
pI
8.45
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
ycgE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1846

This gene is a member of the following regulons

Gene
Coordinates
334,092 → 334,556
The protein
[wiki|Domains]
[wiki|HTH marR-type domain] (aa 7-143) (according to UniProt)
Structure
[PDB|4XRF] (from B. cereus, corresponds to aa 34 ... 136, 32.2% identity)
Expression and Regulation
Operons
genes
[gene|D948867BAEF91943250714453A474B90AB64E523|ycgE]-[gene|78B3F9580DED32469ACF537F4B40C7DBF0D4D995|ycgF]-[gene|CBEC4D299232FC5FCB57211525404CBD42D5AF68|ycgG]
description
[Pubmed|22383849]
Open in new tab

[gene|D948867BAEF91943250714453A474B90AB64E523|ycgE]→[gene|CBEC4D299232FC5FCB57211525404CBD42D5AF68|ycgG]

2022-01-13 07:15:39

Jstuelk

5

9e4dc3e196da00e9a9f5b8fa6cb2ea8e03dfcb45

8155E50B434AD1419E04A02E9BE5DD3290DF4647

Biological materials
Mutant
MGNA-C049 (ycgE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2047 NBRP B. subtilis, Japan]
BKE03080 (Δ[gene|D948867BAEF91943250714453A474B90AB64E523|ycgE]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03080 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAACTGACAGTCCTCCCTAT,  downstream forward: _UP4_TAAGTGAATTTGTGCATAGC
BKK03080 (Δ[gene|D948867BAEF91943250714453A474B90AB64E523|ycgE]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03080 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAACTGACAGTCCTCCCTAT,  downstream forward: _UP4_TAAGTGAATTTGTGCATAGC

D948867BAEF91943250714453A474B90AB64E523

Page visits: 812

Time of last update: 2022-01-17 15:44:56

Author of last update: Jstuelk