SubtiWiki SubtiWiki
yjdA

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yjdA
168

similar to 3-oxoacyl-acyl-carrier protein reductase

locus
BSU_11980
Molecular weight
27.30 kDa
pI
5.7
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yjdA, yidA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1028

This gene is a member of the following regulons

Gene
Coordinates
1,268,829 → 1,269,584
The protein
Protein family
[wiki|Short-chain dehydrogenases/reductases (SDR) family] (according to UniProt)
Structure
[PDB|4JRO] (from ''Listeria Monocytogenes'', 33% identity)
Paralogous protein(s)
[protein|EAEEA4DD9641919830A81185333A2610B964D37C|yhdF], (34%)
[protein|6047F2493FCE3D2A9BDB1AD88E5926ECEED81036|yhxC], (32,9%)
[protein|439B468A13137000FB42E9389391CB4986FFED84|fabG], (30%)
[protein|3161519994609DA9360ED6E073E4A4C8C6210EFB|ydaD], (33,3%)
[protein|248F0805272FED9B38ECBB31E2872BC9EC163CE0|ymfI], (30,8%)
[protein|CE990D33A12C50D22506A52E0099F7D97A762D4E|fadH], (31.9%)
Expression and Regulation
Operons
genes
[gene|D9C06D872E2531B6A72C0AA18B42CEAE09698041|yjcS]-[gene|D9D1FCBFC62F93CAA34DF61A784406F4E9EE6768|yjdA]
description
[Pubmed|22383849]
Open in new tab

[gene|D9C06D872E2531B6A72C0AA18B42CEAE09698041|yjcS]→[gene|D9D1FCBFC62F93CAA34DF61A784406F4E9EE6768|yjdA]

2021-11-18 07:29:52

Jstuelk

5

3466ad3a78b247d984369f95aab4906fd621210b

8AE92FEBA1AEBA1250FCFBEC8E8B5C54592CE518

Biological materials
Mutant
MGNA-A272 (yjdA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/272 NBRP B. subtilis, Japan]
BKE11980 (Δ[gene|D9D1FCBFC62F93CAA34DF61A784406F4E9EE6768|yjdA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11980 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTATTTTAACCTCCAATT,  downstream forward: _UP4_TAAGCTAATGAAACACGGTA
BKK11980 (Δ[gene|D9D1FCBFC62F93CAA34DF61A784406F4E9EE6768|yjdA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11980 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTATTTTAACCTCCAATT,  downstream forward: _UP4_TAAGCTAATGAAACACGGTA

D9D1FCBFC62F93CAA34DF61A784406F4E9EE6768

Page visits: 784

Time of last update: 2022-01-23 02:55:31

Author of last update: Jstuelk