ydbB
Register now for Subtillery 2022, the International Online Meeting on Bacillus subtilis! It will be held from the 19th-22th of September.

ydbB
168

unknown

locus
BSU_04410
Molecular weight
12.80 kDa
pI
5.31
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ydbB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0662

This gene is a member of the following regulons

Gene
Coordinates
495,009 → 495,350
The protein
Protein family
SchB/CurC family (single member, according to UniProt)
[wiki|Domains]
[wiki|cupin 2 domain] (aa 41 ... 88)
Structure
[AF|P96597]
Expression and Regulation
Operons
genes
[gene|D9D4F756999CEC5A116FEE69779F11010D5B5BC4|ydbB]-[gene|EDD5CEDAE74D57627C32EB7C66966CE03B692274|ydbC]
description
[Pubmed|22383849]
Open in new tab

[gene|D9D4F756999CEC5A116FEE69779F11010D5B5BC4|ydbB]→[gene|EDD5CEDAE74D57627C32EB7C66966CE03B692274|ydbC]

2022-08-13 02:14:11

Jstuelk

8

94aa5001da9aa886aa17c42cd458bbc001f3eb50

4D77222B024CF1D60B2DB03134990E0208ED955C

Biological materials
Mutant
MGNA-C098 (ydbB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2096 NBRP B. subtilis, Japan]
BKE04410 (Δ[gene|D9D4F756999CEC5A116FEE69779F11010D5B5BC4|ydbB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04410 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTAGCGAAAACCCCTTTT,  downstream forward: _UP4_ACCGTCATCATAGAGGAGCA
BKK04410 (Δ[gene|D9D4F756999CEC5A116FEE69779F11010D5B5BC4|ydbB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04410 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTAGCGAAAACCCCTTTT,  downstream forward: _UP4_ACCGTCATCATAGAGGAGCA

D9D4F756999CEC5A116FEE69779F11010D5B5BC4

Page visits: 755

Time of last update: 2022-08-15 19:39:18

Author of last update: Melvin.boenninger